ID: 1005044006

View in Genome Browser
Species Human (GRCh38)
Location 6:21624815-21624837
Sequence TGGGGATGACTATGAATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005044006_1005044010 0 Left 1005044006 6:21624815-21624837 CCAGTGATTCATAGTCATCCCCA No data
Right 1005044010 6:21624838-21624860 TTTTACCTTGTCAGTGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005044006 Original CRISPR TGGGGATGACTATGAATCAC TGG (reversed) Intergenic
No off target data available for this crispr