ID: 1005045599

View in Genome Browser
Species Human (GRCh38)
Location 6:21639363-21639385
Sequence GTAGTTCAACAGCTCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005045599_1005045600 -5 Left 1005045599 6:21639363-21639385 CCAGCAGAGAGCTGTTGAACTAC No data
Right 1005045600 6:21639381-21639403 ACTACCTTTTCTCGTTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005045599 Original CRISPR GTAGTTCAACAGCTCTCTGC TGG (reversed) Intergenic
No off target data available for this crispr