ID: 1005054765

View in Genome Browser
Species Human (GRCh38)
Location 6:21719230-21719252
Sequence GGACTTCTTCCCTCCAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005054765_1005054767 -5 Left 1005054765 6:21719230-21719252 CCAGTTCTGGAGGGAAGAAGTCC No data
Right 1005054767 6:21719248-21719270 AGTCCAAAATCAGTGTCACTGGG No data
1005054765_1005054769 4 Left 1005054765 6:21719230-21719252 CCAGTTCTGGAGGGAAGAAGTCC No data
Right 1005054769 6:21719257-21719279 TCAGTGTCACTGGGATGAAAAGG No data
1005054765_1005054766 -6 Left 1005054765 6:21719230-21719252 CCAGTTCTGGAGGGAAGAAGTCC No data
Right 1005054766 6:21719247-21719269 AAGTCCAAAATCAGTGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005054765 Original CRISPR GGACTTCTTCCCTCCAGAAC TGG (reversed) Intergenic
No off target data available for this crispr