ID: 1005054766

View in Genome Browser
Species Human (GRCh38)
Location 6:21719247-21719269
Sequence AAGTCCAAAATCAGTGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005054765_1005054766 -6 Left 1005054765 6:21719230-21719252 CCAGTTCTGGAGGGAAGAAGTCC No data
Right 1005054766 6:21719247-21719269 AAGTCCAAAATCAGTGTCACTGG No data
1005054764_1005054766 -2 Left 1005054764 6:21719226-21719248 CCTTCCAGTTCTGGAGGGAAGAA No data
Right 1005054766 6:21719247-21719269 AAGTCCAAAATCAGTGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005054766 Original CRISPR AAGTCCAAAATCAGTGTCAC TGG Intergenic
No off target data available for this crispr