ID: 1005063963

View in Genome Browser
Species Human (GRCh38)
Location 6:21800254-21800276
Sequence GACACTTTTTTAAAAACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005063963_1005063969 17 Left 1005063963 6:21800254-21800276 CCCCCTGTTTTTAAAAAAGTGTC No data
Right 1005063969 6:21800294-21800316 AGTACATTACCTACTTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005063963 Original CRISPR GACACTTTTTTAAAAACAGG GGG (reversed) Intergenic
No off target data available for this crispr