ID: 1005064131

View in Genome Browser
Species Human (GRCh38)
Location 6:21801808-21801830
Sequence GTGGCCTCATTAGGAAATAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005064131_1005064140 25 Left 1005064131 6:21801808-21801830 CCCGTATTTCCTAATGAGGCCAC No data
Right 1005064140 6:21801856-21801878 CTCTTTTCACATTCTGAAAATGG No data
1005064131_1005064141 26 Left 1005064131 6:21801808-21801830 CCCGTATTTCCTAATGAGGCCAC No data
Right 1005064141 6:21801857-21801879 TCTTTTCACATTCTGAAAATGGG No data
1005064131_1005064135 -7 Left 1005064131 6:21801808-21801830 CCCGTATTTCCTAATGAGGCCAC No data
Right 1005064135 6:21801824-21801846 AGGCCACTGGCCTTCCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005064131 Original CRISPR GTGGCCTCATTAGGAAATAC GGG (reversed) Intergenic
No off target data available for this crispr