ID: 1005072449

View in Genome Browser
Species Human (GRCh38)
Location 6:21874417-21874439
Sequence ATGGGCTTGAAAACTTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005072449_1005072460 25 Left 1005072449 6:21874417-21874439 CCAGGGCAAGTTTTCAAGCCCAT No data
Right 1005072460 6:21874465-21874487 CGGGGCTGTTTCCAGATATCAGG No data
1005072449_1005072458 7 Left 1005072449 6:21874417-21874439 CCAGGGCAAGTTTTCAAGCCCAT No data
Right 1005072458 6:21874447-21874469 TGCGCCTGGAAACAGACTCGGGG No data
1005072449_1005072461 26 Left 1005072449 6:21874417-21874439 CCAGGGCAAGTTTTCAAGCCCAT No data
Right 1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG No data
1005072449_1005072462 30 Left 1005072449 6:21874417-21874439 CCAGGGCAAGTTTTCAAGCCCAT No data
Right 1005072462 6:21874470-21874492 CTGTTTCCAGATATCAGGGCAGG No data
1005072449_1005072457 6 Left 1005072449 6:21874417-21874439 CCAGGGCAAGTTTTCAAGCCCAT No data
Right 1005072457 6:21874446-21874468 CTGCGCCTGGAAACAGACTCGGG No data
1005072449_1005072450 -7 Left 1005072449 6:21874417-21874439 CCAGGGCAAGTTTTCAAGCCCAT No data
Right 1005072450 6:21874433-21874455 AGCCCATCCTGCCCTGCGCCTGG No data
1005072449_1005072456 5 Left 1005072449 6:21874417-21874439 CCAGGGCAAGTTTTCAAGCCCAT No data
Right 1005072456 6:21874445-21874467 CCTGCGCCTGGAAACAGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005072449 Original CRISPR ATGGGCTTGAAAACTTGCCC TGG (reversed) Intergenic
No off target data available for this crispr