ID: 1005072452

View in Genome Browser
Species Human (GRCh38)
Location 6:21874436-21874458
Sequence TTTCCAGGCGCAGGGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005072452_1005072469 30 Left 1005072452 6:21874436-21874458 CCATCCTGCCCTGCGCCTGGAAA No data
Right 1005072469 6:21874489-21874511 CAGGGGGCATGATGGGAGTGAGG No data
1005072452_1005072461 7 Left 1005072452 6:21874436-21874458 CCATCCTGCCCTGCGCCTGGAAA No data
Right 1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG No data
1005072452_1005072462 11 Left 1005072452 6:21874436-21874458 CCATCCTGCCCTGCGCCTGGAAA No data
Right 1005072462 6:21874470-21874492 CTGTTTCCAGATATCAGGGCAGG No data
1005072452_1005072465 14 Left 1005072452 6:21874436-21874458 CCATCCTGCCCTGCGCCTGGAAA No data
Right 1005072465 6:21874473-21874495 TTTCCAGATATCAGGGCAGGGGG No data
1005072452_1005072464 13 Left 1005072452 6:21874436-21874458 CCATCCTGCCCTGCGCCTGGAAA No data
Right 1005072464 6:21874472-21874494 GTTTCCAGATATCAGGGCAGGGG No data
1005072452_1005072460 6 Left 1005072452 6:21874436-21874458 CCATCCTGCCCTGCGCCTGGAAA No data
Right 1005072460 6:21874465-21874487 CGGGGCTGTTTCCAGATATCAGG No data
1005072452_1005072463 12 Left 1005072452 6:21874436-21874458 CCATCCTGCCCTGCGCCTGGAAA No data
Right 1005072463 6:21874471-21874493 TGTTTCCAGATATCAGGGCAGGG No data
1005072452_1005072468 23 Left 1005072452 6:21874436-21874458 CCATCCTGCCCTGCGCCTGGAAA No data
Right 1005072468 6:21874482-21874504 ATCAGGGCAGGGGGCATGATGGG No data
1005072452_1005072467 22 Left 1005072452 6:21874436-21874458 CCATCCTGCCCTGCGCCTGGAAA No data
Right 1005072467 6:21874481-21874503 TATCAGGGCAGGGGGCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005072452 Original CRISPR TTTCCAGGCGCAGGGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr