ID: 1005072459

View in Genome Browser
Species Human (GRCh38)
Location 6:21874451-21874473
Sequence ACAGCCCCGAGTCTGTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 958
Summary {0: 16, 1: 106, 2: 195, 3: 242, 4: 399}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005072459_1005072462 -4 Left 1005072459 6:21874451-21874473 CCTGGAAACAGACTCGGGGCTGT 0: 16
1: 106
2: 195
3: 242
4: 399
Right 1005072462 6:21874470-21874492 CTGTTTCCAGATATCAGGGCAGG No data
1005072459_1005072463 -3 Left 1005072459 6:21874451-21874473 CCTGGAAACAGACTCGGGGCTGT 0: 16
1: 106
2: 195
3: 242
4: 399
Right 1005072463 6:21874471-21874493 TGTTTCCAGATATCAGGGCAGGG No data
1005072459_1005072467 7 Left 1005072459 6:21874451-21874473 CCTGGAAACAGACTCGGGGCTGT 0: 16
1: 106
2: 195
3: 242
4: 399
Right 1005072467 6:21874481-21874503 TATCAGGGCAGGGGGCATGATGG No data
1005072459_1005072460 -9 Left 1005072459 6:21874451-21874473 CCTGGAAACAGACTCGGGGCTGT 0: 16
1: 106
2: 195
3: 242
4: 399
Right 1005072460 6:21874465-21874487 CGGGGCTGTTTCCAGATATCAGG No data
1005072459_1005072465 -1 Left 1005072459 6:21874451-21874473 CCTGGAAACAGACTCGGGGCTGT 0: 16
1: 106
2: 195
3: 242
4: 399
Right 1005072465 6:21874473-21874495 TTTCCAGATATCAGGGCAGGGGG No data
1005072459_1005072464 -2 Left 1005072459 6:21874451-21874473 CCTGGAAACAGACTCGGGGCTGT 0: 16
1: 106
2: 195
3: 242
4: 399
Right 1005072464 6:21874472-21874494 GTTTCCAGATATCAGGGCAGGGG No data
1005072459_1005072470 19 Left 1005072459 6:21874451-21874473 CCTGGAAACAGACTCGGGGCTGT 0: 16
1: 106
2: 195
3: 242
4: 399
Right 1005072470 6:21874493-21874515 GGGCATGATGGGAGTGAGGCTGG No data
1005072459_1005072468 8 Left 1005072459 6:21874451-21874473 CCTGGAAACAGACTCGGGGCTGT 0: 16
1: 106
2: 195
3: 242
4: 399
Right 1005072468 6:21874482-21874504 ATCAGGGCAGGGGGCATGATGGG No data
1005072459_1005072461 -8 Left 1005072459 6:21874451-21874473 CCTGGAAACAGACTCGGGGCTGT 0: 16
1: 106
2: 195
3: 242
4: 399
Right 1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG No data
1005072459_1005072469 15 Left 1005072459 6:21874451-21874473 CCTGGAAACAGACTCGGGGCTGT 0: 16
1: 106
2: 195
3: 242
4: 399
Right 1005072469 6:21874489-21874511 CAGGGGGCATGATGGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005072459 Original CRISPR ACAGCCCCGAGTCTGTTTCC AGG (reversed) Intergenic
902758257 1:18563797-18563819 AAAGCCCCGAGGCTGAGTCCTGG - Intergenic
904572542 1:31477662-31477684 ACGGCACTGAGTCTGTTTCCAGG + Intergenic
904798400 1:33074904-33074926 ACAGCCCTGAGTTTGAGTCCAGG + Intronic
905497380 1:38403419-38403441 ACAGCACTGAGTTTATTTCCAGG - Intergenic
906054004 1:42900137-42900159 ATAGCACCGAGTCTGTTTCCAGG + Intergenic
906403272 1:45521451-45521473 ACAGCCACGAGTCTGGATACAGG + Intronic
906569332 1:46822782-46822804 ACAGCACTGAGTTTATTTCCAGG + Intergenic
906877195 1:49552163-49552185 ACAGCCTTGAGTCTGTTTCCAGG + Intronic
906910508 1:49943914-49943936 ACAGCACTGAGTCTGTTTCCAGG - Intronic
907349109 1:53811403-53811425 ACAGCCCTGAGTCTGTTTCCAGG - Intronic
907399720 1:54217423-54217445 CCAGCCCTGAGTCAGTATCCTGG - Intronic
908175151 1:61547851-61547873 ACAGCCCCAAGTCTGTTGCCAGG + Intergenic
908981705 1:69967080-69967102 ACAGCACAGAGTCTGTTTCCAGG - Intronic
910077565 1:83298820-83298842 ACAGCCCCAAGTCTGTTTCCAGG - Intergenic
910142199 1:84038259-84038281 ACAGCACTGAGTCTGTTTCCAGG + Intergenic
910323426 1:85976277-85976299 ACAGCACTGAGTTTGTCTCCAGG - Intronic
910598556 1:89005713-89005735 ACAGCTCTGAGTCTGTTTCCAGG + Intergenic
910708544 1:90155196-90155218 ACAGCACTGAGTCTATTTCCAGG + Intergenic
910919318 1:92326812-92326834 ACAGCACCAAGTTTGTTTACAGG + Intronic
910919601 1:92329458-92329480 ACAGCACCAAGTTTATTTCCAGG + Intronic
911265923 1:95743032-95743054 ACAGCACTGAGTGTATTTCCAGG + Intergenic
911281106 1:95930085-95930107 ACTGCCCAGAGGCAGTTTCCAGG - Intergenic
911317847 1:96376461-96376483 ATAGCACCAAGTCTGTTTCCAGG - Intergenic
911561989 1:99417819-99417841 ATAGCACTGAGTCTGTTTCCAGG - Intergenic
911743253 1:101410888-101410910 ACAGCACCAAGTTTGTTTCCAGG - Intergenic
912033153 1:105274811-105274833 ACAGCAAGGAGTCTATTTCCAGG + Intergenic
912181116 1:107220215-107220237 ACAGCACTGAGTTTATTTCCAGG + Intronic
912616185 1:111102270-111102292 ACAGCCCCGAGTCTGTTACCAGG + Intergenic
913336726 1:117715787-117715809 ACAACACCGAGTTTATTTCCAGG - Intergenic
913339775 1:117747209-117747231 ACAGCACTGAGTCTGTTTCCAGG + Intergenic
913493487 1:119404999-119405021 ACATCACCGAGTTTGTTTCCAGG - Intergenic
914346029 1:146799264-146799286 ACAGCATTGAGTCTGTTTCCAGG - Intergenic
914927128 1:151898219-151898241 ACATCCCCGTGTCTGTTTCCAGG - Intronic
914967927 1:152277797-152277819 ACTGCCCTGAGGCTGTTTCCAGG - Intergenic
916263706 1:162868994-162869016 ACAACCCCAAGTCTGTTTCCAGG - Intergenic
916331712 1:163625013-163625035 ACAGCACCGAATTTGTTTCCAGG + Intergenic
917318951 1:173758999-173759021 ACAACTCTGAGTCTGTTTCCAGG - Intronic
917461543 1:175234697-175234719 ACAGCCTCGAATCTGTTTCCAGG - Intergenic
917898532 1:179517310-179517332 ACAGCCTTAAGGCTGTTTCCAGG + Intronic
917913693 1:179678269-179678291 ACAGCACCGAGTCTATTTCTAGG + Intronic
918171718 1:182004006-182004028 ACAGCACCGAGTTTATATCCAGG - Intergenic
918589194 1:186221943-186221965 ACAGCACCGACTCTATTTCCAGG - Intergenic
918819781 1:189237273-189237295 ACAGCACCAAGTGTATTTCCAGG + Intergenic
919277873 1:195444791-195444813 ACAGCACCAAGTCTGTTTCCAGG - Intergenic
919397402 1:197068588-197068610 AAAGCACCGAATTTGTTTCCAGG - Intergenic
919520619 1:198582969-198582991 ACAGCACTGAGTCTATTTCCAGG + Intergenic
920727071 1:208446052-208446074 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
920989727 1:210925501-210925523 ACAGCACCGAGTCTATTTCCAGG - Intronic
921409848 1:214823742-214823764 ACTGCCCCCAGACTGTTTCCAGG + Intergenic
921532916 1:216307426-216307448 ACAGCACTGAGTTTATTTCCAGG + Intronic
921762910 1:218937489-218937511 ACAGCACCAAGTTTATTTCCAGG + Intergenic
922396103 1:225202550-225202572 ATAGCACCGGGTCTGTTTCCAGG + Intronic
922657875 1:227401781-227401803 ACAGCACCAAGTCTGTTTCTAGG - Intergenic
922673436 1:227532570-227532592 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
923307411 1:232701169-232701191 ACTGGCCTGAGTTTGTTTCCTGG - Intergenic
923458702 1:234188321-234188343 CCAGCACTGAGTCTGTTTCCAGG - Intronic
923648179 1:235845618-235845640 ACTGCCGGGAGTCTGTTTCCAGG - Intronic
923808690 1:237288672-237288694 ACAGCCCTGAGTCTGTTTCCAGG + Intronic
923874651 1:238034541-238034563 ACAGCCCTGAGCCTGTTTCCAGG - Intergenic
923961152 1:239085039-239085061 AGAGGGCTGAGTCTGTTTCCAGG + Intergenic
924302364 1:242652359-242652381 ACAGCCCCGAGTCTGTTTGCAGG + Intergenic
924321451 1:242855012-242855034 ACAGCACTGAGTCTGTTTCCAGG + Intergenic
924691440 1:246355572-246355594 GCAGCACGGAGTCTGTTTCCAGG - Intronic
924878081 1:248127874-248127896 ACAGCACAGAGTCTGTTTCCAGG + Intergenic
924883322 1:248187096-248187118 ACAGCACCAAGTCTATTTCCAGG + Intergenic
924885400 1:248210202-248210224 ACAGCACCAAGTCTATTTCCAGG + Intergenic
1063561342 10:7130737-7130759 ACGGCACCAAGTCTATTTCCAGG + Intergenic
1064087450 10:12355975-12355997 ACAGCCCCATGGCTCTTTCCAGG - Intronic
1064557241 10:16559598-16559620 ACAGCACCAAGTTTATTTCCAGG + Intergenic
1064868044 10:19904499-19904521 ACAGCATTGAGTCTGTTTCCAGG + Intronic
1065462316 10:25982019-25982041 ACAGCACCCAGTCTATTTCCAGG - Intronic
1065894619 10:30152326-30152348 ACAGCACCGAGTCTATTTCCAGG + Intergenic
1066650959 10:37654728-37654750 ACAGCACTGAGTTTATTTCCAGG - Intergenic
1068480747 10:57585562-57585584 ACAGCCCCAAGTCTGTTTCCAGG - Intergenic
1068925097 10:62527606-62527628 ACAGCACTGAGTTTATTTCCAGG + Intronic
1069112866 10:64468439-64468461 ACAGCATTGAGTCTATTTCCAGG - Intergenic
1069129608 10:64682321-64682343 ACAGCATCAAGTCTATTTCCAGG + Intergenic
1069150550 10:64954095-64954117 ACAGCCCTGGATCTGTTTCCAGG + Intergenic
1069242753 10:66163069-66163091 ACAGCCCCAAGTCTGTTTCCAGG + Intronic
1069325246 10:67225006-67225028 ACAGCCCCAAGTCTGTTTCCAGG - Intronic
1069799748 10:71074772-71074794 TCAGCTCCCAGCCTGTTTCCAGG - Intergenic
1070464892 10:76711590-76711612 ACAGCACCGATTCTGTTTCCAGG - Intergenic
1071024219 10:81093089-81093111 ACAGCACCAAGTCTGTTTCCAGG + Intergenic
1071484700 10:86091266-86091288 ATAGCCCTGAGTCTGTTTCCAGG - Intronic
1072381796 10:94879789-94879811 ACAACACCGAGTCTGTTTCCAGG + Intergenic
1072769612 10:98126499-98126521 ACAGCACCGAGTCTATTTTCAGG + Intergenic
1072885161 10:99266279-99266301 ACAGCACCCAGTTTATTTCCAGG - Intergenic
1073261979 10:102197359-102197381 ACAGTCCCAAGTCTGTTTTTGGG + Intergenic
1073900503 10:108215281-108215303 ACAGCACCGAGTCTGTTTCCAGG + Intergenic
1075247099 10:120832377-120832399 ACAGCACCGAGTTTATTTCCGGG - Intergenic
1075660662 10:124193440-124193462 ATAGCCCCAAGTCTGTTTCCAGG + Intergenic
1075946772 10:126440184-126440206 ATAGCACCAAGTCTGTTTCCAGG - Intronic
1075982798 10:126755766-126755788 ACAACCCCTAGTCTGTTTCCAGG + Intergenic
1076666338 10:132095088-132095110 GCAGCCTTGAGTCTGCTTCCAGG + Intergenic
1076671855 10:132125382-132125404 ACAGACGCGGGTCTCTTTCCAGG + Intronic
1077340206 11:2023069-2023091 CCAGCCTCCAGTTTGTTTCCTGG - Intergenic
1077828031 11:5831609-5831631 ACAGCACCGAGTTTATTTCAAGG + Intronic
1078288554 11:9983212-9983234 GTAGCCCTGAGTCTGTTTCCAGG - Intronic
1079791752 11:24747916-24747938 ACAGCCCTAAGTCTATTTCCAGG + Intronic
1079952194 11:26819378-26819400 ACAGCACCAAGTCTACTTCCAGG + Intergenic
1080153071 11:29076445-29076467 ACAGACCCCAGTCTATTTCCAGG + Intergenic
1080672587 11:34394944-34394966 ATAGCCCCAAGTCTGTTTCCAGG + Intergenic
1080724392 11:34881102-34881124 ACTGCCCCCAGCCTGTTTTCTGG - Intronic
1080923342 11:36730952-36730974 ACAGCACCAAGTTTATTTCCAGG - Intergenic
1081091164 11:38867628-38867650 ACAGCACCAAGTCTATTTCCAGG + Intergenic
1081195228 11:40152573-40152595 ACAGCCCGGAGTCTGTTTCCAGG - Intronic
1081326795 11:41754698-41754720 ACAGCACTGAGTCTATTTCCAGG + Intergenic
1081467372 11:43333828-43333850 ACAGCCATGAGTCGGTTTCCAGG + Intronic
1082120901 11:48378654-48378676 ACAGCACCAAGTCTCTTTTCAGG + Intergenic
1082903867 11:58285227-58285249 ACAGCACTGAGTCTGTTTCCAGG - Intergenic
1082941118 11:58706600-58706622 ACAGCACCAAGTCTATTTCCAGG - Intronic
1083072820 11:60003819-60003841 ACAGCCTTGAGCCTTTTTCCAGG - Intergenic
1084840520 11:71842822-71842844 ATAGCTCGGAGTCTGTTTCCAGG - Intergenic
1085198820 11:74688978-74689000 GCAGCCCTGAGTCTGCTTCTTGG + Intergenic
1085747776 11:79129504-79129526 ACAGCACCGAGTCTGTTTCCAGG - Intronic
1085917119 11:80903269-80903291 ATAGCACCGAGTCTGTTTCCAGG - Intergenic
1086300712 11:85423789-85423811 ACAGAACTGAGTCTATTTCCAGG + Intronic
1086844328 11:91730152-91730174 ACTGCACTGAGTCTATTTCCAGG - Intergenic
1087365455 11:97213007-97213029 ACAGCCTTGATTCTGTTTCCTGG + Intergenic
1087615900 11:100486544-100486566 ACAGCACCAAGTTTGTTTCCAGG - Intergenic
1087619446 11:100525454-100525476 TCAGCCTCGAGTCTTTTTCCAGG - Intergenic
1087688976 11:101297653-101297675 ATAGTACCAAGTCTGTTTCCAGG + Intergenic
1087817599 11:102676417-102676439 ACAGCACTGAGTCTATTTCCAGG + Intergenic
1087901985 11:103651330-103651352 ACAGCACCAAGTTTATTTCCAGG - Intergenic
1088137752 11:106578162-106578184 ACAGCCCCGAGTCTGTTTCCAGG + Intergenic
1088179436 11:107092521-107092543 ACAGCACTGAGTCTGTTTCCAGG - Intergenic
1088206376 11:107397296-107397318 ACAGCGTGGAGTCTGTTTCCAGG - Intronic
1088239488 11:107758820-107758842 ACAGCCCTGAGTCTGTTTCCAGG - Intergenic
1088372491 11:109106841-109106863 ACAGCACCGAGACTATTCCCAGG + Intergenic
1088388075 11:109281786-109281808 ACAACCCTGAGTCTGTTTCCAGG + Intergenic
1089107351 11:116023914-116023936 ACAGCCCCGAGTCTATTTCCAGG - Intergenic
1089647551 11:119890055-119890077 ACTGCCCAGATTGTGTTTCCAGG - Intergenic
1089654897 11:119940210-119940232 AAGGCCCTGAGTCTGTTTCCTGG + Intergenic
1089826415 11:121281896-121281918 ACAGCCCTGAGTCTGTTTGCAGG + Intergenic
1089836917 11:121378949-121378971 ACAGCACCGAGTCTATTTCCAGG - Intergenic
1089954267 11:122555922-122555944 ACAGCACTGAGTCTGTTTCCAGG + Intergenic
1090752997 11:129763785-129763807 ACAGCACTAAGTCTGTGTCCAGG - Intergenic
1090757280 11:129803629-129803651 ACAGCCCTGAGTCTGTTTCCAGG - Intergenic
1090895055 11:130964571-130964593 ACAGCGCTGAGTCTGTTTTCAGG + Intergenic
1202823191 11_KI270721v1_random:78258-78280 CCAGCCTCCAGTTTGTTTCCTGG - Intergenic
1092693649 12:11144453-11144475 ACAGCACCGATTCTATTTCCAGG + Intronic
1093010492 12:14101794-14101816 ACAGCACTGAGTCTGTTTCCAGG - Intergenic
1093172529 12:15875828-15875850 ACAGCCCTGAGTTTGTTTCCAGG - Intronic
1093291120 12:17322915-17322937 ACAGCACAGAGTCTATTTCCAGG + Intergenic
1093409306 12:18845449-18845471 ACAGCACCAAGTCTGTTTCCAGG + Intergenic
1093488775 12:19681530-19681552 ACAGCCCCAAGTCTGTTTCCAGG + Intronic
1093604539 12:21073989-21074011 ACAGCACTGAGTCTATTACCAGG + Intronic
1093758234 12:22876393-22876415 ACAGCACCGAATTTGTTTCCAGG + Intergenic
1093991380 12:25592846-25592868 ACAGCACCAAGTCTGTTTTCAGG - Intronic
1094263492 12:28527960-28527982 AGAGCACCAAGTCTGTTTCCAGG + Intronic
1094342700 12:29430670-29430692 AAAGCACTGAGTCTGTTTCCAGG + Intronic
1094447387 12:30546385-30546407 ATAGCCCCGAGTCTGTTTCCAGG + Intergenic
1094501319 12:31023398-31023420 ACAGCCCTGAGTCTGTTTCCGGG - Intergenic
1094718414 12:33035271-33035293 ACAGACCCAAGTCTGTTTCCAGG + Intergenic
1094722308 12:33077049-33077071 ACAGCACCAAGTCTGTTTCCAGG + Intergenic
1094802121 12:34048781-34048803 ACAGCACTGAGTCTGTTTCCAGG - Intergenic
1095115248 12:38344689-38344711 AGAGCACTGAGTCTGTTTCCAGG - Intergenic
1095176260 12:39095685-39095707 ACAGCACCAAGTATATTTCCAGG - Intergenic
1095248213 12:39946720-39946742 ACAGCCCCAAGTCTGTTTCCAGG + Intronic
1095665144 12:44788791-44788813 ACAGCCCCGAGTCTGTTTCCAGG - Intronic
1095732651 12:45522236-45522258 ACAGCTCTGAGTCTGTTTTCAGG - Intergenic
1095892737 12:47249902-47249924 ACAGCCCTGAGTCTGTTTCCAGG - Intergenic
1095932045 12:47636974-47636996 GTAGTCCCAAGTCTGTTTCCAGG - Intergenic
1096564524 12:52467491-52467513 ACAAAACCGAGTCTGTTTACCGG - Intergenic
1096888637 12:54743850-54743872 AAAGCACCGCCTCTGTTTCCAGG + Intergenic
1096956818 12:55534631-55534653 ACAGCCTCAATTCTGTTTCCAGG - Intergenic
1097295447 12:57958014-57958036 ACAGCCCCAAGTCTGCTTCCAGG - Intergenic
1097760507 12:63459308-63459330 ACAGACCCAAGTCTGTTTCCAGG - Intergenic
1097763385 12:63494677-63494699 ACATACCCGAGTTTGTTTCCTGG - Intergenic
1098500567 12:71187324-71187346 ACAGCACCAAGTTTGTTTCCAGG - Intronic
1098960961 12:76739348-76739370 ACAACTCCGAGTCTGTTTCCAGG + Intergenic
1099041949 12:77667378-77667400 ACAGCATGGAGTCTATTTCCAGG - Intergenic
1099393013 12:82103065-82103087 AAAGCCCCAAGTCTGTTTCCAGG - Intergenic
1099477204 12:83122012-83122034 ACAGCACCGAGTCTGTTTCCAGG + Intronic
1099687474 12:85908250-85908272 ACAGCACTGAGTCTATTTCCAGG + Intergenic
1099777454 12:87151529-87151551 AAGGTCCCTAGTCTGTTTCCAGG + Intergenic
1100088171 12:90936800-90936822 ATGGACCCAAGTCTGTTTCCAGG + Intronic
1100203637 12:92325610-92325632 ACAGCACCAAGTCTGTTTTCAGG + Intergenic
1100706288 12:97203637-97203659 GCAGCATTGAGTCTGTTTCCAGG - Intergenic
1101133476 12:101713510-101713532 ACTTCCCAGAGTCAGTTTCCAGG - Intronic
1101635308 12:106535628-106535650 ACAGCCCTGAATCTGTTTCCAGG + Intronic
1102916780 12:116760208-116760230 ACAGCCCCCAGACCATTTCCAGG + Intronic
1103009074 12:117443932-117443954 AGAGCAGCGAGTCTCTTTCCTGG + Intronic
1103736999 12:123066880-123066902 AAAGCCCTGGGTGTGTTTCCTGG + Intronic
1103761150 12:123251197-123251219 ACTGCCCCGAGTCTGTTTCCAGG + Intronic
1105908214 13:24834955-24834977 TCAGCCCCAAGTCTGTGTCCAGG - Intronic
1105930728 13:25049280-25049302 ACAGCCCCCAGTCTGTTTCCAGG - Intergenic
1106978171 13:35247146-35247168 ACAGCATCAAGTTTGTTTCCAGG + Intronic
1107184792 13:37505639-37505661 ACAGCCCCAAGTCTGTTTCCAGG - Intergenic
1107756044 13:43623118-43623140 ACAGCCCCACGTCTGTTTCCAGG + Intronic
1107819195 13:44271123-44271145 TCAGCCCAGAGTCTGTGTCATGG + Intergenic
1108134183 13:47338053-47338075 ACAGCACCAAGTTTATTTCCAGG - Intergenic
1108188913 13:47917305-47917327 ACAGCACTGAGTTTATTTCCAGG - Intergenic
1108298759 13:49053084-49053106 ACAGCACCGAGTCTATTTCTAGG + Intronic
1108469820 13:50756575-50756597 ACAACCCTGAGGCTGTTTCCAGG + Intronic
1108825505 13:54408041-54408063 ATAGCACCAAGCCTGTTTCCAGG - Intergenic
1108831631 13:54486812-54486834 ACAGCAGCAAGTCTATTTCCAGG - Intergenic
1109071180 13:57771326-57771348 CCAGGCCCGATTCTGCTTCCTGG + Intergenic
1109197163 13:59390751-59390773 ACAGCACCGAGTCTACTTCCTGG + Intergenic
1109213618 13:59563240-59563262 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
1109484549 13:63001823-63001845 ACAGCACCGAGTTTACTTCCAGG - Intergenic
1109508443 13:63337112-63337134 ACAGCCAGAAGTCTCTTTCCAGG + Intergenic
1109534690 13:63700499-63700521 ACAGCACGGAGTTTGTTTCCAGG + Intergenic
1110181759 13:72625918-72625940 ACAGCACTGAGTCTATTTCCAGG - Intergenic
1110561828 13:76917886-76917908 TCAGCCCCCAGACTGTTTCCAGG - Intergenic
1110661242 13:78061157-78061179 ACAGTCCCCAGACGGTTTCCAGG + Intergenic
1110748052 13:79079364-79079386 ACAGGACTGAGTCTGTTTCCAGG - Intergenic
1110852662 13:80262858-80262880 AAAGCCCCCAGTCTGTTTCCAGG + Intergenic
1110881509 13:80577929-80577951 ACAGCCCTGAGTCTGTTTCCTGG - Intergenic
1111165796 13:84455712-84455734 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
1111748547 13:92298183-92298205 ACAGCACCCAGTCTGTTTCCAGG + Intronic
1112035412 13:95492525-95492547 ACAGCCTCGAGTCTGTTTCCTGG + Intronic
1112086954 13:96041653-96041675 ACAGCACTGAGTCTGTTTCCAGG - Intronic
1112945279 13:104920124-104920146 ACAGCCCCGAGTCTGTTTCCAGG - Intergenic
1113269971 13:108662633-108662655 ACAGCCCTGAGTCTGTTCCCAGG + Intronic
1113329917 13:109317739-109317761 ACAACCCTGAATCTCTTTCCAGG - Intergenic
1113638182 13:111936709-111936731 ACAGCACCAAGTCTATTTCCAGG + Intergenic
1114692351 14:24595632-24595654 ACAACCCTGAGTCTGTTTCCAGG + Intergenic
1115265127 14:31492903-31492925 ACAGCCACGAGTCTGTTTCCAGG - Intronic
1115299205 14:31865426-31865448 ACAGCCCTGAGTCTGTTTCCAGG - Intergenic
1115393265 14:32877595-32877617 ACAGCACAGAGTCTATTTCCAGG + Intergenic
1115680282 14:35730515-35730537 ACAACACTGAGTCTGTTTCCAGG - Intronic
1115835527 14:37397832-37397854 ACAACCCCAAGTCTGTTTCCAGG + Intronic
1115938180 14:38578494-38578516 ATAGCACGGAGTCTATTTCCAGG + Intergenic
1115958484 14:38808885-38808907 ACAGCAATGAGTCTGTTTCCAGG - Intergenic
1115969776 14:38932410-38932432 ACAGTGCCAAGTCTGTTTGCAGG - Intergenic
1116012714 14:39369519-39369541 ACAGCCTAGAATCTGTTACCAGG - Intronic
1116049068 14:39781378-39781400 AAAGCCCTGAGTCTGTTTCCAGG + Intergenic
1116063866 14:39958196-39958218 ACAGCACCGAGTCTATATCCAGG - Intergenic
1116335511 14:43651561-43651583 ACAGCACTGAGTCTGTTTCCAGG - Intergenic
1116346669 14:43803074-43803096 ACAGCATTGAGTCTGTTTCCAGG - Intergenic
1116748689 14:48853332-48853354 ACAGCCCTGACCCTGCTTCCAGG + Intergenic
1117112728 14:52475450-52475472 ACAGCACCAAGTCTGTTTCCAGG - Intronic
1117510828 14:56448999-56449021 GTAGCCCCAAGTCTGTTTCCAGG + Intergenic
1117639805 14:57786047-57786069 ACAGCCCTGAGTTTATTTCCAGG - Intronic
1117768441 14:59107622-59107644 ACAGCACCAAGTCTGTTTCCAGG - Intergenic
1118140235 14:63072469-63072491 ACAGCACTGAGTTTATTTCCAGG + Intronic
1118165560 14:63332418-63332440 ACAGCACGGAGTCTGTTTCCAGG - Intergenic
1118532247 14:66719064-66719086 GCAGCACCAAGTCTGTTTCCAGG + Intronic
1119653659 14:76401167-76401189 ACAACTCCCAGTCTGTTTCGAGG - Intronic
1121516643 14:94556589-94556611 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
1123104259 14:105830752-105830774 ACAGCACTGAGTCTGTTTCCAGG + Intergenic
1124380690 15:29162439-29162461 ACCGCCCCAAGTCTGTTTTCGGG - Intronic
1124504984 15:30264833-30264855 ACAGCACTGAGTCTACTTCCAGG - Intergenic
1124505744 15:30271678-30271700 ATAGCCCCCAGTCTCTTTTCTGG - Intergenic
1124557091 15:30736236-30736258 ACAGCCCCAAGTCTGTTTCCAGG - Intronic
1124667870 15:31609350-31609372 ACGGCACCAAGTTTGTTTCCTGG - Intronic
1124674170 15:31669508-31669530 ACAGCCCCAAGTCTGTTTCCAGG + Intronic
1124737809 15:32266954-32266976 ATAGCCCCCAGTCTCTTTTCTGG + Intergenic
1124738568 15:32273802-32273824 ACAGCACTGAGTCTACTTCCAGG + Intergenic
1124910521 15:33915816-33915838 ACAGCACGGAGTTTATTTCCAGG - Intronic
1125055972 15:35359241-35359263 ACACCCCCCAGACTGTTTCTAGG + Intronic
1126123009 15:45270088-45270110 ACAGCCCCCAGTCTTTTCCATGG - Intronic
1126184864 15:45821904-45821926 GCAGCACCAAGTCTATTTCCAGG + Intergenic
1126572678 15:50168812-50168834 ACGGCCCCAAGTCTGTTTCCAGG - Intronic
1126577461 15:50210767-50210789 ACGGCCCCGAGTCTGTTTCCAGG - Intronic
1126977275 15:54197950-54197972 ACAGCACCGAGTCTATTTCCAGG - Intronic
1127008253 15:54594687-54594709 ACATCCCCAAGTCTATTTCTAGG + Intronic
1127194425 15:56568670-56568692 ATAGCACCGAGTCTGTTTCTAGG - Intergenic
1128238679 15:66084928-66084950 ACAGCCCGGAGTCTGTTTCCAGG - Intronic
1128414981 15:67436681-67436703 ACAGCCCCGAGTCTCTTTCCAGG - Intronic
1129562795 15:76589545-76589567 ACAGCACTAAGTTTGTTTCCAGG + Intronic
1130670812 15:85910856-85910878 ACGGCCCTGAATTTGTTTCCAGG - Intergenic
1130847922 15:87764844-87764866 ACAGCCCTGTGTCTTTTTCATGG + Intergenic
1131326881 15:91456379-91456401 ACAGCACCGAGTCTGTTTCCAGG + Intergenic
1132210327 15:100017225-100017247 ACAGCCCCGAGTCTGTTTCCAGG + Intronic
1132857446 16:2053085-2053107 TCAGCCCCCAGTCTGTCACCTGG + Intronic
1133061338 16:3176442-3176464 ACCGCGCCCAGCCTGTTTCCTGG - Intergenic
1133304955 16:4802789-4802811 GCAGCCGCCAGTCTGGTTCCAGG - Exonic
1135883271 16:26279809-26279831 ACAGTACCAAGTCTATTTCCAGG + Intergenic
1135901546 16:26464685-26464707 ATAGCCCTCAGTCTGTTTCCAGG - Intergenic
1136570615 16:31094448-31094470 CCAGCCCCGTGTCCGTTCCCCGG + Intronic
1137533622 16:49300289-49300311 ACAACCCTGTGTCTGTCTCCAGG - Intergenic
1138093449 16:54194559-54194581 TAAGCCCCGAGTCTGATCCCAGG + Intergenic
1138583178 16:57954825-57954847 ACAGCCCCCAGTGTGGTACCTGG - Intronic
1138798010 16:59993386-59993408 ACAGCCTGGAGTCTGTTTCCAGG + Intergenic
1138880977 16:61014684-61014706 ATAGCACTGAGTCTGTTTCCAGG - Intergenic
1139631979 16:68236520-68236542 ACAGCCCCTAGACTGCCTCCTGG - Exonic
1139653950 16:68376354-68376376 CCAGGCCAGAGTCTGTCTCCAGG + Intronic
1139987952 16:70916003-70916025 ACAGCATTGAGTCTGTTTCCAGG + Intronic
1140043482 16:71424811-71424833 ACTGCCCGAAGTCTGTGTCCTGG - Intergenic
1140619782 16:76716353-76716375 GCAGCCCTGAGCCTGTTTCTAGG - Intergenic
1143107695 17:4537723-4537745 ACAGCCCCAAGTGGGTGTCCGGG + Exonic
1144139722 17:12336749-12336771 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
1144164586 17:12596977-12596999 AGAGCCCAGAGTGTGTTGCCAGG - Intergenic
1146583354 17:34059622-34059644 GCAGCACCAAGTCTGTTTGCAGG - Intronic
1146659871 17:34658600-34658622 TCACCCCTGAGTCTGCTTCCTGG + Intergenic
1147463230 17:40589296-40589318 ACAGCACCGAGTCTGTTTCCAGG + Intergenic
1147476331 17:40715223-40715245 CCATCTCAGAGTCTGTTTCCAGG - Intergenic
1147782103 17:42950789-42950811 GCAGCTCTGAGTCTTTTTCCAGG + Intronic
1148329295 17:46803825-46803847 ACAGCCGTGAGCCTGCTTCCGGG - Intronic
1149221379 17:54418455-54418477 ACAGCACCAGGTTTGTTTCCAGG - Intergenic
1150528619 17:65953583-65953605 ACAGCACCGAGTCTATTTCCAGG - Intronic
1150538920 17:66076338-66076360 GCAGCCCCGAGTCTATTTCCAGG - Intronic
1150893628 17:69184003-69184025 ACAGAACTGAGTTTGTTTCCAGG - Intronic
1150945702 17:69743382-69743404 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
1151078764 17:71304536-71304558 ACAGCACCAAGTCTGTTTCCAGG - Intergenic
1152164733 17:78695227-78695249 AAAGCCCCGAATCGGTCTCCTGG - Intronic
1152498402 17:80691691-80691713 TCAGCCACGTGTCTGTCTCCAGG + Intronic
1152757330 17:82092469-82092491 CCAGCCCCGAGGCTGGCTCCGGG + Exonic
1153065413 18:1039636-1039658 ACAGCACCGCATCTGTTTCCCGG - Intergenic
1153072019 18:1116685-1116707 ACAGCCCCGAGTTTATTTCCAGG + Intergenic
1153169007 18:2293680-2293702 ACAGCACCGAGTCTGTTTCCAGG + Intergenic
1153400445 18:4678886-4678908 ACAGCACCGAGTCTGTTTCCAGG - Intergenic
1153965972 18:10182304-10182326 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
1154089975 18:11349248-11349270 ATAGCCCTGAGTCTATTTCCAGG - Intergenic
1154094050 18:11393707-11393729 ACAGCCCAAAGTCTGTTTCCAGG - Intergenic
1154297839 18:13165794-13165816 ACAGCACCGAGTTTGTTTCCAGG - Intergenic
1156011420 18:32501549-32501571 ACAGCACTGAGTCTGTTTCCAGG + Intergenic
1156331522 18:36128643-36128665 ACAGCTCCGAGCCTTTCTCCAGG + Intronic
1156351553 18:36306291-36306313 ACAGCCTCGAGTGTGTTTCTGGG + Intronic
1156607158 18:38680005-38680027 ACAGCACCAAGGCTATTTCCAGG + Intergenic
1156667458 18:39425365-39425387 GCAGCACCGAGTTTGTTTCTAGG - Intergenic
1156893397 18:42215694-42215716 ACAGCACCAAGTTTGTTTCCAGG + Intergenic
1156944627 18:42814349-42814371 ATAGCACCGAGTCTGTTTCCAGG - Intronic
1157120549 18:44906277-44906299 ATAGCCCCTAGTTTCTTTCCTGG - Intronic
1157218564 18:45806997-45807019 ATAGCACTGAGTCTGTTTCCAGG - Intergenic
1157609864 18:48949632-48949654 TCAGCCCCCAGTCTCTTCCCAGG + Intronic
1158331553 18:56368226-56368248 ACAGCCCAGAGTCTGTTTCCAGG + Intergenic
1158829723 18:61263947-61263969 TTAGCCCCAAGTCTTTTTCCAGG - Intergenic
1159383327 18:67690773-67690795 ACAACTCTAAGTCTGTTTCCAGG + Intergenic
1159454070 18:68638767-68638789 ACAGCACGGAGTTTGTTTCCAGG + Intergenic
1159787055 18:72726993-72727015 ATAGCACCAAGTCTGTTTCCAGG - Intergenic
1159808911 18:72992690-72992712 ACAGCCCTGAGTTTCTTTCTAGG - Intergenic
1159838416 18:73369210-73369232 ACAGCACTGAATCTATTTCCAGG - Intergenic
1159906502 18:74097363-74097385 ACAGCACCAAGTCTGTTTCCAGG - Intronic
1160267632 18:77353914-77353936 ACAGCCCCAAATCTGTTTCCAGG + Intergenic
1162497023 19:11029081-11029103 ACAGACACGAGTCTGTTGCAGGG + Intronic
1162718140 19:12646827-12646849 ATATCCCCGAATCTGTCTCCAGG + Intronic
1164107970 19:22125569-22125591 ACAGCACCAAGTCTGTTTCCAGG - Intergenic
1164237808 19:23352171-23352193 ACAGCCCCGAGTCTGTTTCCAGG - Intronic
1164251699 19:23482937-23482959 ACAGACCTGAGTCTGTTTCCAGG - Intergenic
1164267417 19:23632761-23632783 ACAGCCCCGAGCCTTCTTCCAGG - Intronic
1165180838 19:33966638-33966660 AGAGCCACAAGTCTGTATCCTGG + Intergenic
1165201519 19:34148766-34148788 ACAGCCTCCAGTCTGTTTCCAGG + Intergenic
1165969775 19:39617741-39617763 ACAGCACTGAGTTTGTTTCCAGG - Intergenic
1166604296 19:44126900-44126922 ACAGCCCTGAGTCTGTTTCCAGG + Intronic
1166899584 19:46049397-46049419 ACAGCACCAAGTTTATTTCCAGG - Intronic
1167757444 19:51421550-51421572 GCAGCCTCAAGTCTGTTTTCTGG + Intergenic
1167879578 19:52444863-52444885 ACAGCAGGAAGTCTGTTTCCAGG + Intronic
1168236566 19:55067403-55067425 ACAGCCCGGAGTCTCCTCCCTGG - Intronic
925343274 2:3151288-3151310 ACAGCACCGAGTCTGTTTCCAGG - Intergenic
925479177 2:4251169-4251191 ACAACACCGAGACTGTTTCCAGG + Intergenic
925795701 2:7539880-7539902 ACAGCAGTGAGTCTATTTCCAGG + Intergenic
926556023 2:14359004-14359026 ACAGCACTGAGTCTATTTCCAGG - Intergenic
926872783 2:17441409-17441431 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
926916045 2:17893278-17893300 ACAGCCTGGAGTCTGTTTCCAGG + Intronic
927355416 2:22167490-22167512 ACAGCACCGGGTTTATTTCCAGG - Intergenic
928733703 2:34261517-34261539 ACAGCACCGAGTCTATTTCCAGG - Intergenic
928772576 2:34719835-34719857 ATGGCCCCCAGACTGTTTCCAGG + Intergenic
928783112 2:34848755-34848777 ACAGCACCAACTCTATTTCCAGG + Intergenic
929805973 2:45145322-45145344 ACAGCACAGAGTCTGTTTCCAGG - Intergenic
930046966 2:47181011-47181033 ACAGCCCAGAGCCTGCTTCCAGG - Intergenic
930422915 2:51176706-51176728 ACAGCACTGAGTTTATTTCCAGG - Intergenic
930486542 2:52017999-52018021 GCAGACCTGAGTCTGTTTCCAGG + Intergenic
930593079 2:53353468-53353490 ACAGTACCAAGTCTATTTCCAGG - Intergenic
931137019 2:59414396-59414418 ACAGCACTGAGTCTGTTTCCAGG + Intergenic
931368030 2:61636388-61636410 TCATCTCAGAGTCTGTTTCCTGG - Intergenic
931525259 2:63145617-63145639 ACAGTCCTGAGTCTTTTTCCAGG + Intronic
931547838 2:63408681-63408703 ACAGTCCCAAGTCTGTTTCCAGG - Intronic
932100699 2:68896800-68896822 AGAGCCCCGGGTCCGTTTCCAGG + Intergenic
932384934 2:71323537-71323559 ACAGCACTGAGTCTGTTTCCAGG + Intronic
933397548 2:81752556-81752578 ACAGCACGGAGTTTGTTTCCAGG - Intergenic
933531481 2:83517556-83517578 ATAGCTCCGAGTCTGTTTCCAGG - Intergenic
935007083 2:99089537-99089559 ACAACACCAAGTTTGTTTCCAGG - Intronic
936115907 2:109702851-109702873 GCAGCCCCACCTCTGTTTCCAGG - Intergenic
936164419 2:110107322-110107344 GCAGCCCCAAGTCTGTTTCTAGG - Intronic
936701019 2:115011911-115011933 GCAGCACCGAGTCTATTTCCAGG - Intronic
936857672 2:116979983-116980005 ACAGCACCGAGTTTATGTCCAGG - Intergenic
937057819 2:118954199-118954221 ACAGCCCCAAGTGTGTTTCCAGG - Intronic
937069304 2:119050530-119050552 ACAGCCCCAAGTCTGTTTCCAGG + Intergenic
937336056 2:121062980-121063002 CCAGCCCCTAGTCTGCTGCCCGG + Intergenic
937340737 2:121088942-121088964 ACAGCCCCGAGCCTGCATCATGG - Intergenic
937521752 2:122720763-122720785 ACAGCCCCAAATCTGTTTCCAGG - Intergenic
937699473 2:124847477-124847499 ACAGCATCGAGTCTATATCCAGG + Intronic
937723085 2:125126412-125126434 ACAGCACCAAGTCTGTTTCCAGG + Intergenic
937767661 2:125680353-125680375 ACAGCCCTGAGTCTTTTTCCAGG + Intergenic
937828976 2:126399552-126399574 ACAGCACCAAGTCTGTTTCCAGG + Intergenic
938564283 2:132503958-132503980 ACAGCACTGAGTCTATTTCCAGG + Intronic
938598305 2:132811630-132811652 ACAGCCCTGAGTCTGTTTCCAGG + Intronic
938996345 2:136683047-136683069 ACAGCACGTAGTCTATTTCCAGG - Intergenic
939199558 2:139017720-139017742 TCAGCCCCGACTTTGTTTTCTGG + Intergenic
939769536 2:146298664-146298686 ACAGTCCCGAGTCTGTTTTTAGG - Intergenic
940172406 2:150843243-150843265 ATAACCCCAAGTCTGTTTCCAGG + Intergenic
940709421 2:157144179-157144201 ACAGCCCCAAGTCTGTTTCCAGG + Intergenic
940762359 2:157751581-157751603 ACAGCACCAAGTTTGTTTCCAGG - Intronic
940785021 2:157971857-157971879 ACAGCAACAAGTCTGTTTCCAGG + Intronic
940796841 2:158089339-158089361 ACAGCACTGAGTTTGTTTCCAGG + Intronic
941357861 2:164514842-164514864 ACAGCACTGAGTATTTTTCCAGG - Intronic
941593884 2:167452038-167452060 ACAGCACCGGGTTTATTTCCGGG + Intergenic
941627401 2:167844876-167844898 ACAGCCCCCAGTCTGTTTCCAGG - Intergenic
941631661 2:167891311-167891333 ACAGCACTAAGTCTGTTTCCAGG + Intergenic
941702075 2:168614501-168614523 ACAGCACCAAGTTTGTTTCCAGG - Intronic
941738388 2:169005563-169005585 ACAGCACTGAATCTATTTCCAGG + Intronic
942071963 2:172324387-172324409 GCCTCCCTGAGTCTGTTTCCTGG - Intergenic
943129648 2:183839810-183839832 ACAGCACTGAGTCTGTTTCCAGG - Intergenic
943621185 2:190150077-190150099 ACAGCCCCCAATCCGTTTCCAGG + Intronic
943665896 2:190607895-190607917 TCATCTCAGAGTCTGTTTCCAGG - Intergenic
943891286 2:193290111-193290133 AGAGCCCAGAGTCCATTTCCAGG + Intergenic
943909291 2:193542516-193542538 ACAGCACTGAATCTGTTTCCAGG - Intergenic
944073165 2:195695466-195695488 GAAGCACCGAGTCTATTTCCAGG + Intronic
944145468 2:196503234-196503256 AAAGCCCCAAGCCTGTTTCTTGG - Intronic
944432116 2:199644892-199644914 ACAACATCAAGTCTGTTTCCAGG + Intergenic
944528915 2:200648948-200648970 ACAGCCCTGAGTTTGTTTGCAGG + Intronic
944874083 2:203944002-203944024 ACCGCCCCAAGTCTGTTTCCAGG + Intronic
945108205 2:206337109-206337131 CCATCTCAGAGTCTGTTTCCAGG - Intergenic
945377332 2:209094353-209094375 ACAGCACTAAGTCTATTTCCAGG + Intergenic
945482616 2:210361029-210361051 ACAGCACCCAGTCTGTTTCCAGG + Intergenic
945536688 2:211026318-211026340 ACAGCACTAAGTTTGTTTCCAGG + Intergenic
945825607 2:214716968-214716990 ACAGCCCTGAGTCTGTTTCCAGG - Intergenic
945864500 2:215161517-215161539 ACAGCCCAGAGTCTGTTTCCAGG - Intergenic
946036419 2:216746078-216746100 ATAGCCCTGAGTCTGTTTCCAGG - Intergenic
947270289 2:228326964-228326986 ACAGCACCGAGTCTGCTTCCAGG - Intergenic
947457118 2:230265327-230265349 ACAGCCCCCAGACCATTTCCAGG + Intronic
948234586 2:236379007-236379029 ACTCCCCCGACTGTGTTTCCAGG + Intronic
948531157 2:238606532-238606554 ACAGCACTGAGTTTGTTTCCAGG - Intergenic
948713939 2:239846912-239846934 ACAGCACCAAGTTCGTTTCCAGG - Intergenic
1169401291 20:5282769-5282791 ACAGCACCAAGTCTGTTTCCAGG - Intergenic
1169517509 20:6333393-6333415 ACAGCCCCGAGTCTGTTTCTAGG + Intergenic
1170086223 20:12535380-12535402 ACAGCACCCAGTCTACTTCCAGG - Intergenic
1170241789 20:14174527-14174549 ACAGCACTGAGTTTATTTCCAGG + Intronic
1170375855 20:15699610-15699632 ACAGCCCCGAGTTTGTTTCCAGG + Intronic
1170483742 20:16794273-16794295 ATAGCACCAAGTCTGTTTCCAGG + Intergenic
1170721059 20:18879493-18879515 ACAGTCCAGAGTCTCTTTCTAGG + Intergenic
1170727643 20:18943840-18943862 ACAGCACTGAGTCTATTTCCAGG + Intergenic
1171038717 20:21739807-21739829 ACAGCACTGAGTTTATTTCCAGG + Intergenic
1171066965 20:22026824-22026846 ACAGCACCAAGTTTATTTCCAGG + Intergenic
1171160340 20:22916608-22916630 ACAGCACCAAGCCTGTTTCCAGG + Intergenic
1171165564 20:22967326-22967348 ACAGCCCCAAGTCTGTTTCCAGG - Intergenic
1171242401 20:23582231-23582253 ATAGCCCCAAGTCTGTTTCTAGG + Intergenic
1172149759 20:32781319-32781341 ACAGCCAGGAGTCTGTTTTGTGG - Intronic
1172515011 20:35527376-35527398 AGTGTCCAGAGTCTGTTTCCTGG - Intronic
1172638202 20:36424103-36424125 GCAAACCTGAGTCTGTTTCCTGG - Intronic
1172851479 20:37969338-37969360 ACAGCACTGAGTCTATTTCCAGG + Intergenic
1173565541 20:44035786-44035808 CCATCTCGGAGTCTGTTTCCAGG - Intronic
1173568339 20:44058245-44058267 ACAGCACCGAGTTTATTTCCAGG - Intronic
1174076722 20:47942591-47942613 TCATCCCAGAGTCTGTTTCTGGG - Intergenic
1175465140 20:59185659-59185681 ACAGCCCGGAGTGTGCGTCCAGG - Intergenic
1175807568 20:61838261-61838283 GCAGCCCCGTGTGTGTTCCCAGG + Intronic
1177140481 21:17352884-17352906 ACAGCACCGAGTCTGTTTGTAGG - Intergenic
1177174476 21:17689392-17689414 ACAGCCCAGAATCTGTTTCCAGG + Intergenic
1177176428 21:17704885-17704907 ACAGCACCAAGTGTGTTTCCAGG - Intergenic
1177195623 21:17901051-17901073 ACAGCCTTGAGTCTGTTTCCAGG + Intergenic
1177847378 21:26306260-26306282 ACAGCACTGAGTCTATTTCTAGG - Intergenic
1178479757 21:32969408-32969430 ACAGCACTGTGTCTGTTTCCAGG + Intergenic
1178801641 21:35801199-35801221 ACAGGCCTGAGTCTGTTTCCAGG - Intronic
1179084241 21:38203342-38203364 ACAGCACTGAGTCTGTTTCCAGG + Intronic
1179255303 21:39710773-39710795 CCATCTCAGAGTCTGTTTCCTGG - Intergenic
1180087805 21:45515902-45515924 ACAGCCCCCAGGCTGTCTTCTGG + Exonic
1181402935 22:22662302-22662324 CCATCTCAGAGTCTGTTTCCAGG + Intergenic
1181601130 22:23952447-23952469 ACAGGGCCCAGTCTGCTTCCGGG + Intergenic
1182155515 22:28068605-28068627 ACAGATCCAAGTCTGTTTCAAGG + Intronic
1183048483 22:35241284-35241306 ACAGCCCCAAATATGTTTCCAGG + Intergenic
1183250454 22:36726485-36726507 ACAGCCTCGGGTCTGATTTCTGG + Intergenic
1183988937 22:41585104-41585126 ACAGCCCAGAGGCTGTTGCGGGG + Intronic
1184352144 22:43951584-43951606 ACAGCCCAGGGGCTCTTTCCTGG + Intronic
1184545343 22:45163839-45163861 TCAGCCCCGCGCCGGTTTCCAGG + Exonic
1185266898 22:49909025-49909047 CCAGCCCTCAGGCTGTTTCCTGG + Intronic
949377333 3:3405124-3405146 ACAGCACCAAGTTTATTTCCAGG - Intergenic
949604081 3:5634554-5634576 ACAGGCCAGAGTCTGTTTCCAGG + Intergenic
949814210 3:8040904-8040926 ACAGCTCTGGGTTTGTTTCCAGG - Intergenic
950391932 3:12703585-12703607 AAAGCCCCGGGTCAGCTTCCTGG - Intergenic
950603586 3:14057983-14058005 ACAGCACCAAGTCTGTTTCCAGG + Intronic
951269576 3:20608143-20608165 ACAGCCCCAAGTCTGTTTCCAGG - Intergenic
951750119 3:26025541-26025563 ACAGCACTGAGTCCATTTCCAGG + Intergenic
951761152 3:26148572-26148594 AAAGCACTGAGTCTGTTTCCAGG - Intergenic
951967091 3:28399067-28399089 ACATCACCAAGTCTGTTTCCAGG - Intronic
952082831 3:29781762-29781784 ACAGCACTGAGTCTATTTCCAGG - Intronic
952522450 3:34174898-34174920 ACAGCACTGAGTTTGTTTCCAGG + Intergenic
953185258 3:40631604-40631626 ACAGCACTGAGTTTATTTCCCGG - Intergenic
953495155 3:43379627-43379649 ACAGCGCTGAGTTTATTTCCAGG - Intronic
953723985 3:45381752-45381774 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
953770854 3:45777788-45777810 ACTGACCTGAGTCTGTTCCCTGG + Intronic
954705953 3:52480577-52480599 ACAGCCCCGAGCCTGTTCAGAGG - Intronic
955175676 3:56611441-56611463 CATCCCCCGAGTCTGTTTCCAGG + Intronic
955461656 3:59189865-59189887 ATAGCCCTGAGTCTGTTTCCAGG + Intergenic
957016428 3:75069662-75069684 ATAGCCCTGCATCTGTTTCCAGG + Intergenic
957427870 3:80063746-80063768 ACAGCCCCGAGTCTGTTTCCAGG - Intergenic
958263016 3:91404330-91404352 ACAGCCCCAGATCTGTTTCCAGG + Intergenic
958480819 3:94643610-94643632 ACAGCCCTGAGTCTGTCTCCAGG + Intergenic
958490525 3:94766507-94766529 ACAGCCCTAAGTCTGTTTCCAGG + Intergenic
958647145 3:96887952-96887974 ACAACTCCCAGTCTGTTTCTAGG + Intronic
958770634 3:98421755-98421777 ACAGCACCAAGTCTGTTTCCAGG - Intergenic
958969977 3:100600829-100600851 ACAGCCCCGAGTCTGTGTCCAGG + Intergenic
959275260 3:104269841-104269863 ACAGCCCCCAGTGTGTTTCCAGG + Intergenic
959715774 3:109431322-109431344 ATAGCACTGAGTTTGTTTCCAGG + Intergenic
959899010 3:111639254-111639276 ACAGCCCCGAGTCTGTCTCCAGG - Intronic
960064318 3:113354420-113354442 ACAGCACTAAGTCTATTTCCAGG - Intronic
960512882 3:118571830-118571852 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
960516507 3:118608114-118608136 ACAGCACTGAATCTGTTTCTAGG - Intergenic
960574846 3:119219295-119219317 CCAGCTCAGAGTCTGTTTCCTGG + Intronic
960756419 3:121019001-121019023 ACAGCACAGAGTTTATTTCCCGG - Intronic
960898059 3:122526983-122527005 ACAGCTCTGAGTCTACTTCCAGG - Intergenic
960916238 3:122697893-122697915 ACAGACCTGAGTTTGATTCCTGG + Intronic
961967992 3:130925988-130926010 ACATCACCAAGTCTTTTTCCAGG + Intronic
962034416 3:131636264-131636286 ACAGCACCAAGTCTATTTTCAGG - Intronic
962147458 3:132855459-132855481 ACAGCACCAAGTCTATTTGCAGG + Intergenic
962393311 3:134992265-134992287 ACGGCCTGGAGTCTGTTTTCAGG + Intronic
962401886 3:135067552-135067574 ACAGCACGGAGTCAGTTTCCAGG + Intronic
962764531 3:138549331-138549353 ACAACACCAAGTTTGTTTCCAGG - Intronic
962984020 3:140518157-140518179 ACAGCACCGAGTTTATTTCCAGG + Intronic
963522550 3:146373226-146373248 ACAGCATCGAGTCTATTTCCAGG + Intergenic
963832431 3:150022769-150022791 ACAGCACCAAGTCTATTTCTAGG - Intronic
964017452 3:151964809-151964831 ACAGCACCAAGTCTATTTCCAGG - Intergenic
964075632 3:152688516-152688538 ACAGCACCAAGTTTATTTCCAGG - Intergenic
964188956 3:153980209-153980231 ATAGCTCCAAGTCTGTTTCCAGG - Intergenic
964226421 3:154408453-154408475 ACAGCCTTGCGTCTATTTCCAGG - Intronic
964248666 3:154684586-154684608 ATAGCACCGCGTTTGTTTCCGGG + Intergenic
964601292 3:158503745-158503767 ACAGCCCTGAGTCTGTTTCCAGG + Intronic
964643788 3:158936765-158936787 AAAGCCCCAAGTCTGTTTCCAGG - Intergenic
964794020 3:160478616-160478638 ACAGCACTGAGTCTATTTCCAGG - Intronic
964917517 3:161854683-161854705 ACAGCCCCGAGTCTGTTTCCAGG + Intergenic
965052737 3:163671468-163671490 ACAGCCTCAAGTCTATTTCCAGG + Intergenic
965184526 3:165446335-165446357 ACACCACCAAGTCTATTTCCAGG - Intergenic
965296686 3:166955859-166955881 ACAGCAATGAGTCTATTTCCAGG + Intergenic
965874417 3:173299646-173299668 ACAGCACCAAGTCTGTTTCCAGG + Intergenic
966020461 3:175202989-175203011 ACAGCCCCAAGTCTGTTTCCAGG + Intronic
966229955 3:177640939-177640961 ACAGCACCGAGTCTATTTCCAGG + Intergenic
966686674 3:182703335-182703357 ACAGCACAGAGTTTGTTTCCAGG + Intergenic
966992045 3:185242728-185242750 ACAGCACTGAGTCTGTTTCCAGG + Intronic
967209040 3:187150417-187150439 ACAGCTCTAAGTCTGTTTCCAGG - Intronic
967257551 3:187609194-187609216 ACAGCACTGAGTCTGTTTCCAGG + Intergenic
967399906 3:189049274-189049296 ACAGCCCCAAGCCTGTTTCCAGG - Intronic
967651311 3:191990123-191990145 ACAGCACCAAGTTTGTTTCCAGG - Intergenic
968229941 3:196999591-196999613 ACAGCCCTGAGCCAGCTTCCAGG - Intronic
969228450 4:5814028-5814050 GCAGCCCCGAGTCTGTGCCCAGG - Exonic
969781606 4:9408816-9408838 ATAGCCCGGAGTCTGTTTCCAGG - Intergenic
970312033 4:14792938-14792960 TGAGCACCAAGTCTGTTTCCTGG - Intergenic
970346614 4:15158955-15158977 ACAGCCCCAAGTCTGTTTCCTGG + Intergenic
970549344 4:17163765-17163787 ACAGCACCAATCCTGTTTCCAGG + Intergenic
970658663 4:18260397-18260419 ACATCCCCAAGTCTGTTTTCAGG + Intergenic
971050448 4:22855706-22855728 ACAGCACCAAGTCTGTTTCCAGG + Intergenic
971183163 4:24349661-24349683 ACAGCCCCAAGTCTGTTTCCAGG + Intergenic
971576352 4:28280274-28280296 ACAGCACTGAGTTTATTTCCAGG - Intergenic
971901035 4:32658365-32658387 ACAGCTATAAGTCTGTTTCCAGG + Intergenic
972189105 4:36568802-36568824 ACAGCAGCAAGTCTGTTTCAAGG + Intergenic
973070855 4:45856520-45856542 ACAGCACCGAGTCTGTCTCCAGG + Intergenic
973179616 4:47251848-47251870 ACAGCCCTGAGTCTATTTTCAGG + Intronic
973334408 4:48941852-48941874 CCATCTCGGAGTCTGTTTCCAGG - Intergenic
973782368 4:54300564-54300586 ACAGCCCTGAGTCTGTTTCCAGG - Intergenic
973920070 4:55675418-55675440 ACAGCACTGAGTTTATTTCCAGG - Intergenic
974127120 4:57710022-57710044 ACAGCACCAAGTTTGTTTCCAGG - Intergenic
974165049 4:58191037-58191059 ACAGCACTGAGTGTGCTTCCAGG - Intergenic
974474481 4:62361756-62361778 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
974801843 4:66828322-66828344 ACAACACCAAGTTTGTTTCCAGG + Intergenic
974950929 4:68582398-68582420 ATAGTCCCGAGTCTTTTTCAAGG - Intronic
975033778 4:69657007-69657029 ACAACCTGGAGTCTGTTTCCAGG - Intergenic
975301070 4:72791786-72791808 ACAGCACTGAGTTTATTTCCAGG - Intergenic
975365238 4:73521096-73521118 AAAGCACCAAGTCTATTTCCAGG + Intergenic
975509760 4:75181174-75181196 ACAGCACCAAGTTTATTTCCAGG - Intergenic
975517224 4:75260120-75260142 ACATCCCTGAGTCTGTTTCCAGG - Intergenic
975680157 4:76868153-76868175 AGAGCCCCCAGACCGTTTCCAGG - Intergenic
975942783 4:79668156-79668178 ACAGCACCGAGTCTATTTCCAGG - Intergenic
976462896 4:85333466-85333488 ACAGCACCAAGTTTATTTCCAGG - Intergenic
976686377 4:87819619-87819641 ACATCCCCAAGTCTGTTTCCAGG + Intergenic
976791221 4:88880739-88880761 ACAGCTCTGAGTTTATTTCCAGG - Intronic
976856446 4:89610054-89610076 ACCGCCCCCAGACCGTTTCCAGG - Intergenic
977020029 4:91747103-91747125 ACAGCCCCTAGTCTGTTTCCAGG + Intergenic
977777496 4:100938748-100938770 ACAGCACTGAGTCTATTCCCAGG - Intergenic
978202000 4:106033050-106033072 ACAGCACTGAGTCTATTTCCAGG + Intergenic
978670665 4:111244248-111244270 ACAGCCCCCAGACTGTTTCCAGG - Intergenic
979160072 4:117448514-117448536 ACTGCACCGAGTTTATTTCCAGG + Intergenic
979498465 4:121411526-121411548 ACAACCTTAAGTCTGTTTCCAGG + Intergenic
979704813 4:123709136-123709158 ACAGACCCAAGTCTGTTTCCAGG - Intergenic
979794924 4:124834521-124834543 ACAGCCCCAAGTTCATTTCCAGG + Intergenic
979995436 4:127425999-127426021 GCGGCCCTGAGTCTGTTTCCAGG - Intergenic
980087224 4:128403769-128403791 ACAGCCCAGAGTCCGTTTCTGGG + Intergenic
980195109 4:129578320-129578342 ACAGCACCAAGTCTATTTGCAGG + Intergenic
980237790 4:130131452-130131474 ACAGCACCAAGACTGTTCCCAGG - Intergenic
980409992 4:132404182-132404204 ACAGCACTGAGTCTATTTCCAGG + Intergenic
980761466 4:137239117-137239139 ACAGCACCGAGTCTATTTCCAGG + Intergenic
980861092 4:138500249-138500271 ACAGCACTGAATCTATTTCCAGG + Intergenic
981366961 4:143914728-143914750 ACAGCACCGAGTCTGTTTCCAGG - Intergenic
981376756 4:144024966-144024988 ACAGCACCGAGTCTGTTTCAAGG - Intergenic
981387256 4:144146312-144146334 ACAGCACTGAGTCTGTTTCAAGG - Intergenic
981461067 4:145014218-145014240 ACAGCACTGAGTCTGTTTCCAGG - Intronic
981559690 4:146033363-146033385 GCAGCCGGGAGTCTGTTTCCAGG - Intergenic
982074968 4:151730068-151730090 CACACCCCGAGTCTGTTTCCAGG - Intronic
982189972 4:152843777-152843799 ACAGCCCTGAGTCTGTTTCAAGG + Intronic
982299544 4:153865140-153865162 ACAGCACCAAGTTTATTTCCAGG + Intergenic
982312190 4:153997537-153997559 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
982450992 4:155552317-155552339 GCAGCCCCAAGTTTATTTCCAGG - Intergenic
982491710 4:156038526-156038548 ACAGCACCAAGTCTGTTTCTAGG - Intergenic
982960355 4:161827809-161827831 ACAGCACAGAGTTTGTTTCCGGG + Intronic
983035851 4:162864940-162864962 ACAGCACTGAGTTTGTTTCCAGG - Intergenic
983277413 4:165635501-165635523 ACAGCACCAAGTTTATTTCCAGG - Intergenic
983449751 4:167895260-167895282 ACAGCCCCGAGTCTGTTTCCAGG - Intergenic
983754653 4:171320056-171320078 ACAGCACTGAGTTTATTTCCAGG - Intergenic
984234249 4:177137140-177137162 ACAGAACCAAGTCTATTTCCAGG - Intergenic
984475019 4:180224901-180224923 ATAGCACCGAGTCTGTTTCAAGG + Intergenic
984527586 4:180875616-180875638 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
984721646 4:182978219-182978241 ACAGCCCCGAGTCTGTTTCCAGG - Intergenic
985092852 4:186381751-186381773 ACAGCCCCCAGTCCGTTTCCAGG - Intergenic
985217803 4:187672096-187672118 ACAGCCCCCAGTCCGTTTCCAGG + Intergenic
985240843 4:187929598-187929620 ACAGCACCAAATCTGTTTCCAGG + Intergenic
985288574 4:188362776-188362798 ACAGCCCCGAGTCTGTTTCCAGG - Intergenic
985561944 5:592434-592456 ACAGCACAAAGTCTGTCTCCGGG + Intergenic
986258963 5:6126037-6126059 ATAGCACCAAGTCTATTTCCAGG - Intergenic
986633951 5:9801657-9801679 ACAGCATTGAGTCTATTTCCAGG - Intergenic
986705173 5:10448591-10448613 ACAGCCCCAAGTCACTATCCAGG + Intronic
986870199 5:12036596-12036618 ACAGCAGCGAGTCTATTTCCAGG - Intergenic
987577688 5:19752310-19752332 ATAGCATCTAGTCTGTTTCCAGG - Intronic
987640096 5:20601594-20601616 ACAGCACTGAGTCTATTACCAGG - Intergenic
988344566 5:30020903-30020925 ACACCCTCTAGGCTGTTTCCAGG - Intergenic
988421232 5:31008303-31008325 ACAGCACCAAGTCTATTTCCAGG + Intergenic
988712620 5:33793776-33793798 ACAATCCCAAGTCTGTTCCCAGG + Intronic
988723594 5:33903531-33903553 ACAGCACCGAGTCTGTTTCCAGG + Intergenic
988902191 5:35745450-35745472 ACAGCCCCGAGTCTGTTTCCAGG - Intronic
989529197 5:42486999-42487021 ACTGACCTGAGTTTGTTTCCTGG + Intronic
989538558 5:42591952-42591974 ACAGCACCGAGTCTATTTCCAGG + Intronic
990233299 5:53739111-53739133 ATAGCCCCAAGTCTGTTTCCAGG - Intergenic
990243475 5:53838701-53838723 ACAGCACCGAGTTTGTTTCCAGG - Intergenic
990572746 5:57095216-57095238 ACAGCACCTAGTCTGTTTCCAGG - Intergenic
990712867 5:58604665-58604687 ACAGCCCCAATTCTGTTTCCAGG + Intronic
992766997 5:80010605-80010627 CCATCTCAGAGTCTGTTTCCTGG - Intronic
993742975 5:91562907-91562929 ACAGCACCAAGTTTGTTTCCAGG - Intergenic
993917013 5:93756006-93756028 ACAGCCCTGAGTCTGTGTCCAGG - Intronic
993920548 5:93795316-93795338 ACAGCACCGAGTCTATTTCTAGG + Intronic
993964737 5:94346941-94346963 ACAGCCCCCAGACCTTTTCCAGG - Intronic
994222221 5:97208875-97208897 ACAGCACCAAGTCTGTTTCTGGG + Intergenic
994883606 5:105529448-105529470 ACAGTCCTGAGTCTGTTTCCAGG + Intergenic
995317936 5:110797516-110797538 ACAGCACCAAGTCTGTTTCCAGG + Intergenic
995473045 5:112523482-112523504 ACAGCCCCCAGACCGTTTCCAGG + Intergenic
995722468 5:115151160-115151182 ACAGTACCAAGTTTGTTTCCAGG - Intronic
995817773 5:116191424-116191446 AGAGCCCCAAGTCTGTTTCCAGG - Intronic
995955284 5:117769739-117769761 ACAGCATTGAGTCTGTTTCCAGG - Intergenic
996010717 5:118478975-118478997 ACAGTCCCGAGTCTGTTTCCAGG - Intergenic
996080773 5:119255828-119255850 ACAGCACCTAGTTGGTTTCCAGG - Intergenic
996124183 5:119706305-119706327 GTAGCCCCGAGTCTGTTTCCAGG + Intergenic
996495328 5:124148802-124148824 ACAGCCCAGAGTTTATTTCCAGG + Intergenic
996504826 5:124257375-124257397 AACAGCCCGAGTCTGTTTCCAGG + Intergenic
996875406 5:128235345-128235367 ACAGCACCCAGTCTATTTCCAGG + Intergenic
997106019 5:131019943-131019965 ACAGCACCAAGTCTGTTTCCAGG + Intergenic
997231136 5:132243878-132243900 ACAGTACTGAGTCTATTTCCAGG + Intronic
997332109 5:133071712-133071734 TCACCCCAGAGTCTGTTGCCTGG + Intronic
997760886 5:136446357-136446379 ACAGCCCCTAGACGGTTTCCAGG - Intergenic
998777516 5:145619043-145619065 ACAGCACTGAGCCTGTTTCCAGG + Intronic
999484894 5:151985522-151985544 ACAGCACCAAGTCTGTTTCTAGG + Intergenic
999491064 5:152052196-152052218 ACAGCACTGAGTTTATTTCCAGG + Intergenic
999677066 5:154014933-154014955 ACCACACTGAGTCTGTTTCCAGG - Intronic
999818472 5:155200806-155200828 ACAGCCCCAAGTCTGTTTCCAGG - Intergenic
1000511653 5:162190374-162190396 ATAGCACCGAGTCTGTTTCCAGG + Intergenic
1000757949 5:165184333-165184355 ATAACCCTGAGTCTCTTTCCAGG + Intergenic
1000779609 5:165464808-165464830 ACAGCTCGGAGTTTGTTTCCAGG - Intergenic
1001177177 5:169481123-169481145 ACAGCACTGAGTTTGTTTCCAGG + Intergenic
1002059240 5:176616692-176616714 TCAGCCCAGAGCCTGTTTCCAGG + Intergenic
1003029465 6:2589430-2589452 ACAGCCCTGAGTCTGTTTTTAGG + Intergenic
1003063108 6:2877511-2877533 ATAGCCCTGCATCTGTTTCCAGG - Intergenic
1003240882 6:4344709-4344731 ATAGCCCCGAGGCTGGTGCCTGG + Intergenic
1003450843 6:6230223-6230245 ACAGCCCTAAGTCCATTTCCAGG - Intronic
1003711953 6:8602556-8602578 ACAGCCCTGAGTTTGTTTCCAGG + Intergenic
1003863049 6:10339349-10339371 ACACCCCCTAGCCTGTTTACAGG + Intergenic
1004888496 6:20074670-20074692 ACAGCACTGACTCTATTTCCAGG - Intergenic
1005072459 6:21874451-21874473 ACAGCCCCGAGTCTGTTTCCAGG - Intergenic
1005191456 6:23228682-23228704 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
1005244082 6:23861938-23861960 ACAGCACTGAGTCTATTTCCAGG - Intergenic
1005760236 6:28961058-28961080 ACAGCACCAAATCTGTTTCCAGG - Intergenic
1005885495 6:30094376-30094398 TCTCCCCCGACTCTGTTTCCAGG - Intergenic
1005973836 6:30782074-30782096 ACAGCCGGAAGTCTGTTTCCTGG - Intergenic
1006842520 6:37038858-37038880 CTAGCCCCTACTCTGTTTCCTGG - Intergenic
1007197312 6:40073898-40073920 ACAGCACTGAGTTTATTTCCAGG + Intergenic
1007428700 6:41763938-41763960 ACAACCCAGATTCTGTATCCTGG + Intergenic
1007892624 6:45310063-45310085 ACAGCCCCAAGTCTGTTTCCAGG - Intronic
1008231185 6:48986601-48986623 ACAGCACTGAGTTTATTTCCAGG - Intergenic
1008305291 6:49892223-49892245 ACAGCCCTGAGTCCATTTCCAGG - Intergenic
1008402355 6:51078379-51078401 ACAGCACTGATTCTATTTCCAGG + Intergenic
1008528658 6:52434040-52434062 ACAGCACCAAGTCTGTTTCCAGG + Intronic
1008775437 6:55032183-55032205 ACAGCACCAAGTCTGTTTCCAGG + Intergenic
1008992390 6:57618557-57618579 ACAGACCCAGATCTGTTTCCAGG - Intronic
1009181014 6:60517670-60517692 ACAGCCCCAGATCTGTTTCCAGG - Intergenic
1009453137 6:63825033-63825055 ACAGCCCCGAGTCTATTCCCAGG - Intronic
1009798486 6:68502724-68502746 ACAGCACCAATTCTGTTTCCAGG - Intergenic
1009866882 6:69408957-69408979 ACAGCACCAAGTCTATTTGCAGG - Intergenic
1009968741 6:70604475-70604497 ACAGCCCTGAATCTGTTACCAGG - Intergenic
1010027774 6:71239781-71239803 ACAGCATCGAGTCTATTTCCAGG - Intergenic
1010076406 6:71803572-71803594 ACAGCACCAAGTCTGATTCCAGG + Intergenic
1010165143 6:72906257-72906279 GCAGCACTGAGTCTGTTTCCAGG + Intronic
1010200185 6:73275377-73275399 ACAGATCCCAGTCTGTTTGCAGG + Intronic
1010500476 6:76593734-76593756 ACAGCACCGAGTTTGTTTCCAGG - Intergenic
1010633711 6:78231192-78231214 ACAGCACCAAGTTTGTTTCCAGG + Intergenic
1010679292 6:78781091-78781113 ACAGCCCTGAGTCTGTTTCCAGG - Intergenic
1010707796 6:79135231-79135253 ACAGCACAGAGTCTGTTTCCAGG + Intergenic
1011093553 6:83633738-83633760 ACAGCACTGAATGTGTTTCCAGG + Intronic
1011133180 6:84072935-84072957 ACAGCCCCTAATCTGTTTCCAGG + Intronic
1011168597 6:84479292-84479314 ATAGCCCCAAGTCTGTTTCCAGG - Intergenic
1011233289 6:85187756-85187778 ACAGCCCCAAGTCTGTTTCCAGG - Intergenic
1011320012 6:86080663-86080685 ACAGTACTGAGTCTGTTTCCAGG + Intergenic
1011375547 6:86682413-86682435 ACAGCACCAAGTTTATTTCCAGG + Intergenic
1011620452 6:89237600-89237622 ACAGCACCAAGTTTGTTTCTAGG + Intergenic
1011626906 6:89290479-89290501 ACAGCCCTGAGCCTGCCTCCAGG - Intronic
1011789783 6:90885680-90885702 ACAGCCCCGAGTCTGTTTCCAGG + Intergenic
1011832190 6:91387461-91387483 ACAGCACTGAGTTTATTTCCAGG - Intergenic
1011833695 6:91404324-91404346 ACAGCACCAAGTCTCTTTCCAGG - Intergenic
1011893345 6:92194272-92194294 ACATCCCCCAGTCCGTTTCCAGG + Intergenic
1011924002 6:92618487-92618509 ACAGCACCAAATCTATTTCCAGG + Intergenic
1011965906 6:93156970-93156992 ACAGCACCAAGTCTATTTCAAGG + Intergenic
1012225039 6:96694188-96694210 ACAGCACTGAGTCTGTTTCCAGG - Intergenic
1012299273 6:97563925-97563947 AAAGCACTGAGTCTATTTCCAGG + Intergenic
1012864060 6:104596366-104596388 ACATCTCAGAGTCTGTTTCTAGG + Intergenic
1013721078 6:113028561-113028583 AGAGCCCAGAGTCTGTTTCCAGG + Intergenic
1013852672 6:114534799-114534821 ACAGCCCCTAGACCTTTTCCAGG + Intergenic
1013913800 6:115310392-115310414 ACAGCACCAAGTTTCTTTCCAGG + Intergenic
1013946619 6:115729247-115729269 ACAGCATCGAGTTTATTTCCAGG + Intergenic
1014304854 6:119727680-119727702 ACAGCACAGAGTCTGTTTCCAGG + Intergenic
1014420327 6:121235612-121235634 ACAGCACCAAGTCTATTTCCAGG + Intronic
1014531425 6:122563823-122563845 ACAGCCCCAAGTCTGTTTCCAGG + Intronic
1014738738 6:125124236-125124258 ACAGCCAAGAGTCTGTTTCCAGG - Intronic
1014743325 6:125170923-125170945 ACAGCCCTGAGAGTGTTACCAGG + Intronic
1015347804 6:132180176-132180198 ACAGCACCAAGTTTATTTCCAGG - Intergenic
1015849828 6:137560325-137560347 ACAGCACAGAGTCTGTTTCCAGG + Intergenic
1016175920 6:141077622-141077644 ACAGCACCAAGTTTGTTTCCAGG - Intergenic
1017190521 6:151648553-151648575 ACAACTCTGAGTCTGTTTCCAGG + Intergenic
1017663431 6:156695844-156695866 CCAGCTCAGAGTCTGTTTCCAGG + Intergenic
1018034606 6:159871544-159871566 ACAGCTCTGAGCCTGCTTCCAGG - Intergenic
1018114981 6:160574262-160574284 ACAGCTCCAAGTCTGTTTCCAGG + Intronic
1018732856 6:166665873-166665895 ACGGCCCCCAGCCTGCTTCCTGG + Intronic
1018755242 6:166843014-166843036 ACAGCACCGAGTCTATTTCTAGG - Intronic
1019621624 7:1995290-1995312 GCAGCCCCGGGGCTGGTTCCAGG - Intronic
1020028598 7:4917289-4917311 ACAGCCCCGTGTCAGGTTGCTGG - Intronic
1020373664 7:7461517-7461539 ACAACACTGAGTCTGTTTCCAGG - Intronic
1020860758 7:13489378-13489400 ACAGCCCTGAGTCTGTTTCTAGG - Intergenic
1020915210 7:14184408-14184430 ACAGACCCGAGTTAGTTTCCAGG - Intronic
1022777746 7:33545054-33545076 ACAGCCCCGACTCTGTTTCTAGG + Intronic
1022894894 7:34740263-34740285 ACAGCACTGAGTTTGTTTCCAGG + Intronic
1023648688 7:42345741-42345763 ACAGCCCTGGGTCTGAATCCTGG - Intergenic
1023657641 7:42441130-42441152 ATAGCACTGAGTCTATTTCCAGG + Intergenic
1024000546 7:45186526-45186548 TCATCCCCGAGTCTGTTCTCTGG + Intergenic
1024174725 7:46827541-46827563 ACAGCACCAAGTTTATTTCCAGG - Intergenic
1024295173 7:47836062-47836084 ACAGGCCCTGGTCTATTTCCAGG + Intronic
1024455740 7:49604853-49604875 ACAGCACTGAGTTTATTTCCAGG - Intergenic
1024545439 7:50513605-50513627 AGAGCCCCAAGTCTGTTTCTGGG - Intronic
1024665632 7:51544273-51544295 ACAGCACTGAGTTTATTTCCAGG + Intergenic
1024880348 7:54078657-54078679 ACACCCCCGTGTCTTTTTCTGGG - Intergenic
1024917929 7:54524807-54524829 ATAGCACCAACTCTGTTTCCAGG + Intergenic
1026285093 7:68955709-68955731 ACAGGCCTGTGTGTGTTTCCCGG - Intergenic
1026944561 7:74307319-74307341 CCAGACCCGGGTCTGATTCCAGG + Intronic
1027295340 7:76764025-76764047 ACAGCCCCAAGTCTGTTTCCAGG - Intergenic
1027417680 7:77990412-77990434 ACAGCACCAAATCTGTTTCCAGG + Intergenic
1028250955 7:88539693-88539715 ACAGCACTGAGTCTATTTCCAGG + Intergenic
1028501802 7:91527477-91527499 ATAACACCGAGTCTATTTCCAGG - Intergenic
1028822531 7:95229393-95229415 ACAGCACCAAGTCTATTTCCAGG - Intronic
1028962268 7:96762013-96762035 ACAGCACTGAGTCTGTTTCCAGG + Intergenic
1028993613 7:97076167-97076189 ACACCGCCTAGTCTGTCTCCAGG + Intergenic
1030325176 7:108211514-108211536 ACAGCCCCAAGTCTGTTTCCAGG - Intronic
1030533432 7:110737305-110737327 ATGGCACTGAGTCTGTTTCCAGG - Intronic
1030935959 7:115585180-115585202 ACAACCCCCAGTCTGTTTCCAGG - Intergenic
1030972287 7:116075508-116075530 ACAGCACCAAGTCTGTTTCCAGG - Intronic
1031046776 7:116898420-116898442 ACAGCACCTAGTCTGTTTCCTGG + Intronic
1031261330 7:119524929-119524951 ATAGCACCAAGTCTATTTCCAGG - Intergenic
1031740071 7:125418594-125418616 ACAGCATCAAGTCTGTTTCTAGG - Intergenic
1031761286 7:125716173-125716195 ACAGCACAGAGTCTGTTTCCTGG + Intergenic
1031879193 7:127177131-127177153 GTAGCCCCGAGTCTGTTTCCTGG - Intronic
1032448948 7:132010099-132010121 ACGGCACCAAGTCTATTTCCAGG + Intergenic
1032922695 7:136567233-136567255 ACAGCACCAAGTCTGTTTCCAGG + Intergenic
1033026789 7:137782223-137782245 ACAGCACCGAGTCTATTTCCAGG - Intronic
1034247918 7:149662986-149663008 ACAGCACCGAGTTTATATCCAGG + Intergenic
1034422657 7:150997491-150997513 CCAGCCCCGAGTCTGTGGGCTGG - Intronic
1034705520 7:153139666-153139688 GCAGCACCGAGTTTGTTTCTAGG + Intergenic
1034927911 7:155138118-155138140 TCATCTCAGAGTCTGTTTCCTGG - Intergenic
1035078059 7:156194050-156194072 CCATCTCAGAGTCTGTTTCCTGG - Intergenic
1035591534 8:818365-818387 ACAGTACCGAGTCTATTTCCAGG + Intergenic
1035595137 8:851792-851814 CCAGCTCCGAGTGTGGTTCCTGG - Intergenic
1036771346 8:11580325-11580347 ACTGCCCTGAGCCTGTGTCCCGG + Intergenic
1036814022 8:11887892-11887914 ACAGCCCCCATTCTACTTCCTGG - Intergenic
1036837814 8:12089914-12089936 ATAGCCCGGAGTCTGTTTCCAGG + Intergenic
1036859604 8:12336162-12336184 ATAGCCCGGAGTCTGTTTCCAGG + Intergenic
1037320849 8:17641131-17641153 ACAGCACCGAGTTTGTTTCTAGG + Intronic
1038908715 8:31937643-31937665 ACAGCACTGAGTCTATTTCCAGG - Intronic
1039001034 8:32980103-32980125 ACAGCACCCAGTTTATTTCCAGG + Intergenic
1039083323 8:33755533-33755555 ACAGCCTCGAGTATGTTTCCAGG + Intergenic
1039095579 8:33881084-33881106 ACAGCACTAAGTCTGTTTCCAGG + Intergenic
1039144975 8:34437607-34437629 ACAGCACTGAGTTTATTTCCAGG - Intergenic
1039571795 8:38592835-38592857 ACAGCACCAAGTCTGTTTCCAGG - Intergenic
1039810535 8:41044141-41044163 ACAGCACCGAGTCTGTTTCCAGG + Intergenic
1040635707 8:49270651-49270673 ACAGCCCTGAGCCTGTTTTCAGG + Intergenic
1040800219 8:51331614-51331636 ACAGCCCCTAGTCTGTTTCCAGG - Intronic
1041293790 8:56333635-56333657 ACGTCCCCAAGTCTGTTTCCAGG + Intergenic
1041352901 8:56966750-56966772 CCAGCTCCAAGTCTGATTCCTGG + Intronic
1041570590 8:59333294-59333316 ACAACCCCCAGTCTGTTTCCAGG + Intergenic
1041637064 8:60156314-60156336 ACAGCCCCCAGACCGTTTCCAGG - Intergenic
1041878020 8:62712601-62712623 ACAGCCCTGAGTGTGTTTCCAGG + Intronic
1041879819 8:62736546-62736568 ACAGCACCAAGTTTATTTCCAGG + Intronic
1042122906 8:65507590-65507612 ACAGCCCCCAGTCCATTTCCAGG + Intergenic
1042176813 8:66045628-66045650 ACAGGCTCCAGGCTGTTTCCAGG + Intronic
1042304174 8:67314126-67314148 ACAGCCCCAAGTCTGTTTCCAGG + Intronic
1042467167 8:69141018-69141040 ACAGCCCCCAGACAGTTTCCAGG + Intergenic
1042768459 8:72352867-72352889 ACAGCACTGAGTTTATTTCCAGG + Intergenic
1043040754 8:75259460-75259482 ACAGCACCAAGTCTGTTTCCAGG - Intergenic
1043048019 8:75352223-75352245 ACAACACTAAGTCTGTTTCCAGG - Intergenic
1043556795 8:81439459-81439481 ACAGCACTGAGTGTATTTCCAGG + Intergenic
1043678894 8:82996874-82996896 ACAGCACTGAGTTTATTTCCAGG - Intergenic
1043816915 8:84812774-84812796 ACAGCCCCAAGTTGGTTTGCAGG + Intronic
1043876467 8:85491869-85491891 GCAGCACCGAGTCTATTTCCAGG + Intergenic
1044227510 8:89736288-89736310 ACAGCTCTGAGTATGTTTCCAGG - Intergenic
1044805071 8:95998410-95998432 ACAGCCCAGAGACAGTCTCCAGG + Intergenic
1044903297 8:96972133-96972155 ACAGCACTGAATCTATTTCCAGG - Intronic
1044907216 8:97017539-97017561 ACAGCACCAAGTCTGTTTCCAGG - Intronic
1044947943 8:97408273-97408295 ACAGTACCGAGTCCATTTCCAGG + Intergenic
1045671020 8:104553374-104553396 ACAGCACCAAGTTTATTTCCAGG - Intronic
1045779792 8:105849608-105849630 ACAGCCCCAAGTCTGTTTCTAGG - Intergenic
1045814317 8:106261685-106261707 ACAGCACCAAGTGTATTTCCAGG + Intergenic
1045994156 8:108343126-108343148 ACAGCACTGAGTGTGTTTCCAGG - Intronic
1046074377 8:109299382-109299404 ACAGCACCAAGTCTGTTTCCAGG - Intronic
1046394589 8:113625415-113625437 ACAGCATCGAGTTTGTTTCCAGG - Intergenic
1047032326 8:120896206-120896228 ACAGCCCGGAGTCTGCTTCCAGG - Intergenic
1047770807 8:128028367-128028389 ACAGCCCAGAGTCCTTTCCCAGG + Intergenic
1047901913 8:129431963-129431985 ACAGCACCAAGTTTATTTCCAGG + Intergenic
1048531160 8:135251650-135251672 ACAGCACTGACTCTATTTCCAGG + Intergenic
1048993511 8:139775073-139775095 ACAGCCCCAAGGATGCTTCCTGG - Intronic
1049300553 8:141867260-141867282 ACAGCCCCCAGCCTGATTCCTGG - Intergenic
1050034961 9:1425191-1425213 ACAGCCCTGTCTCTGATTCCAGG - Intergenic
1050400420 9:5247874-5247896 ACAGCACCTAGTCTGTTTCCAGG - Intergenic
1050502648 9:6315086-6315108 ACAGCCCCTAGTCTGTTTCCAGG - Intergenic
1050903427 9:10974562-10974584 ACAGCTCCAAGTCTATTCCCAGG - Intergenic
1051053354 9:12955934-12955956 ACAGCACCGAATTTATTTCCAGG + Intergenic
1051362646 9:16294699-16294721 ACAGCCCTGAATCCGTTTCCAGG - Intergenic
1051929374 9:22366863-22366885 ACAGCAGCAAGTCTATTTCCAGG - Intergenic
1052537104 9:29761416-29761438 AAAGCACGGAGTCTGTTTTCAGG - Intergenic
1052550189 9:29938158-29938180 ATAGCACTGAGTCTGTTTCCAGG + Intergenic
1052731499 9:32291422-32291444 ATAGTCCCGAGTCTGTTTCCAGG + Intergenic
1052835065 9:33244372-33244394 ATAGCTCAGAATCTGTTTCCTGG - Intronic
1052894556 9:33735039-33735061 ACAGCACCAAGTCTGTGTCCAGG - Intergenic
1053442184 9:38125678-38125700 ACAGCTCTGATTCTTTTTCCTGG + Intergenic
1053469486 9:38336039-38336061 ACAGCTCCAAGTCTGTTTTTGGG + Intergenic
1053560783 9:39191778-39191800 AAAGCCCCGTGCCTGATTCCAGG - Intronic
1054136336 9:61427177-61427199 AAAGCCCCGTGCCTGATTCCAGG + Intergenic
1054605686 9:67175335-67175357 AAAGCCCCGTGCCTGATTCCAGG + Intergenic
1055156287 9:73066832-73066854 ACAGCACTGAGTCTATTTCCAGG - Intronic
1055272250 9:74574236-74574258 CCAGCCCTGAGTCAGTTTCAGGG + Intronic
1055736235 9:79334258-79334280 ACAGTACCAAGTCTGTTTCCAGG - Intergenic
1055905852 9:81292636-81292658 ACAGCCCCAAGTCTGTTTCCAGG + Intergenic
1056163829 9:83923021-83923043 ACCGCGCCGAGCCTGTTTTCAGG + Intergenic
1056396562 9:86186774-86186796 ACAGCACCGAGTCTATTTCCAGG - Intergenic
1056571478 9:87820605-87820627 ACAGCCCTGATTCAGTTCCCTGG + Intergenic
1056699073 9:88887264-88887286 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
1058085075 9:100739933-100739955 ACCGCCCGGAGTCTGTTTCCAGG + Intergenic
1058233549 9:102461483-102461505 ACAGCACCAAGTGTATTTCCAGG - Intergenic
1058308437 9:103471533-103471555 ACAGCACCGAGTCTGTTTCCAGG + Intergenic
1058410362 9:104724836-104724858 ACAGCCCCGAGTCTGTGTCCAGG - Intergenic
1058623237 9:106905754-106905776 ACAGCCCCGAGTCTGTTTCCAGG + Intronic
1059673750 9:116516744-116516766 ACAGCACCAAGCCTATTTCCAGG - Intronic
1060234333 9:121852033-121852055 CCAGCCCCGAGTCTCAGTCCTGG - Intronic
1060400125 9:123343838-123343860 GCAGTCCAGAATCTGTTTCCAGG - Intergenic
1062440949 9:136569010-136569032 ACAGCCCCCATCCTGTGTCCTGG + Intergenic
1062614300 9:137389059-137389081 TCTGCCACGAGTCTGTCTCCTGG + Intronic
1062713535 9:137990084-137990106 ACAGCACTGAGTCTATTTCCAGG - Intronic
1187219234 X:17307935-17307957 ACGGCCCCGAGTCGGCTTCCAGG + Intergenic
1187588806 X:20693302-20693324 ACAGCACTGAGTCTATTTCCAGG - Intergenic
1187748349 X:22433473-22433495 ACAGCCCCAAGTCTTTTTCCAGG - Intergenic
1187773641 X:22730690-22730712 ACAGCCCTGAGTCTGTTTCTAGG + Intergenic
1188045940 X:25426304-25426326 ATAGCCCCAAGTCCATTTCCAGG + Intergenic
1188309557 X:28599768-28599790 TCATCTCGGAGTCTGTTTCCAGG - Intronic
1188389393 X:29600932-29600954 ACAGCACTGAGCCTATTTCCAGG + Intronic
1188738040 X:33742304-33742326 ACAGCCCTGAGTATGTTTACAGG + Intergenic
1189218128 X:39344836-39344858 ACAGCCCTGAGTCTGTTTCCAGG - Intergenic
1189567156 X:42254880-42254902 ACAGCACCAAGTCTATTTCCAGG - Intergenic
1189603144 X:42648610-42648632 AAAGCCCAGAGTCTGTTTGCAGG - Intergenic
1189668298 X:43380967-43380989 ATAGCACCGAGTTTGTTTCCAGG - Intergenic
1189879217 X:45471571-45471593 ACAGCCCCCAGTCCATTTCCAGG + Intergenic
1189962127 X:46333736-46333758 ACAGCCCCCAGTCTGTTTCCTGG - Intergenic
1190448891 X:50557885-50557907 ACAGCCCCAAGTCTGTTTCCAGG - Intergenic
1190632158 X:52398714-52398736 ACAGCACCAAGTCTGTTTCCAGG + Intergenic
1190895515 X:54614280-54614302 ACAGCCCCAAGTCTGTTTCCAGG + Intergenic
1191018918 X:55839982-55840004 ACAGCACCAAGTTGGTTTCCAGG + Intergenic
1191045309 X:56129800-56129822 ACAGCACCAAGTTTGTTTCCAGG - Intergenic
1191080329 X:56504114-56504136 ACAGCACTGAGTCTATTTCCAGG - Intergenic
1191080612 X:56505900-56505922 ACAGCCCCAAGTCTGTTTCCAGG - Intergenic
1191100264 X:56719218-56719240 ACAGCACTGAGTTTGTTTCTAGG - Intergenic
1191138584 X:57092656-57092678 ACAGAACCGAGTTTGTTTTCAGG - Intergenic
1191144908 X:57155517-57155539 ATAGCACTGAGTTTGTTTCCAGG + Intergenic
1191151854 X:57228004-57228026 ACAGCCCTGAACCTGTTTCCAGG + Intergenic
1191223285 X:58014424-58014446 ACAGCACAGAGTTTATTTCCAGG + Intergenic
1191692291 X:63952801-63952823 ACAGCACCAAGTTTGTTTCTAGG - Intergenic
1191713672 X:64179037-64179059 ACAGACCCAAGTCTTATTCCTGG - Intergenic
1191903604 X:66064544-66064566 GCAACCCCAAGTCTGTTTCCAGG + Intergenic
1191909327 X:66131143-66131165 ACAGCACCGAGTGTACTTCCAGG + Intergenic
1191917217 X:66215868-66215890 ACAGCACTGAGTTTATTTCCAGG - Intronic
1191954098 X:66625297-66625319 ACAGTCCCAAGTCTGTTTCCAGG - Intronic
1191970986 X:66815788-66815810 ACAGCACTGAGTTTATTTCCAGG + Intergenic
1192069101 X:67918272-67918294 ACAGCACCGAGTCCATTTCCAGG + Intergenic
1192609584 X:72554454-72554476 ACAGCACTGAGTCTATTTCCAGG - Intronic
1192820179 X:74636932-74636954 ACAGCACCAAGTCTGTTTCCAGG - Intergenic
1192853032 X:74977730-74977752 GCAGCACCGAGTCTATTTCCAGG + Intergenic
1192869469 X:75172444-75172466 ACAGCACCAAGTTTGTTTCCAGG + Intergenic
1192881148 X:75285159-75285181 ACAGCCCCAAGTCTGTTTCCAGG + Intronic
1192914556 X:75638441-75638463 ACAGCCCCGAGTCTGTTTCCAGG + Intergenic
1192950840 X:76014619-76014641 ACAGCACCAACTTTGTTTCCAGG - Intergenic
1192968215 X:76202538-76202560 ACAGCACCAAGTCTGTTTCCAGG + Intergenic
1192979081 X:76319310-76319332 ACAGCCCTGAGTCTTTTTCTAGG + Intergenic
1192991852 X:76467721-76467743 ACAGCACCGAATTTATTTCCAGG + Intergenic
1193016653 X:76741355-76741377 ACAGCACCGAGTCTATTTCCAGG - Intergenic
1193077940 X:77375164-77375186 ACAGCACTGAGTTTGTTTCCAGG - Intergenic
1193154560 X:78158695-78158717 ACAGCCCCAAGTCTCTTTCCAGG - Intergenic
1193156816 X:78183128-78183150 ACAGCCCAGGGTCTGTTTCCAGG - Intergenic
1193404219 X:81082444-81082466 AAAGCACTGAGTCTGTTTTCAGG - Intergenic
1193420773 X:81279963-81279985 ACAGCCCTGAGTCTGTTTCCAGG - Intronic
1193423795 X:81316331-81316353 ACAACACGGAGTTTGTTTCCAGG + Intergenic
1193541296 X:82775615-82775637 ACAGCCCTGAGTTTATTTCCAGG + Intergenic
1193643918 X:84044208-84044230 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
1193779677 X:85686420-85686442 ACAGCCCTGAGTCTGTTTCCAGG + Intergenic
1193791610 X:85821655-85821677 GCAGCACCGAGTCTGTTTCCAGG - Intergenic
1193826337 X:86231602-86231624 ACAACCCCAAGTCTGTTTCCAGG + Intronic
1193937587 X:87641671-87641693 ACAGCCCCAAGTCTGTTTCCAGG - Intronic
1194231541 X:91331215-91331237 ACAGCACTGACTCTATTTCCAGG - Intergenic
1194237167 X:91399063-91399085 ACAGCACCAAGTCTGTTTCCAGG - Intergenic
1194299122 X:92163197-92163219 ACAGTGCTGAGTTTGTTTCCAGG + Intronic
1194380892 X:93190661-93190683 ACAGCAAGGAGTCTATTTCCAGG - Intergenic
1194470281 X:94285492-94285514 ACAGCACCAAGTCTATTTCCAGG + Intergenic
1194471441 X:94302601-94302623 ACAGCTCTAAGTTTGTTTCCAGG + Intergenic
1194605664 X:95975071-95975093 ACAGCCCCAAGTCTGTTTGCAGG - Intergenic
1194701532 X:97119904-97119926 ACAGCAACGAGTCTGTTTCCAGG + Intronic
1194765263 X:97841927-97841949 GCTGGCCCGAGTCTGGTTCCTGG - Intergenic
1194926956 X:99836712-99836734 ACAGCCCTGAGTCTGTTTCTAGG + Intergenic
1194932192 X:99901564-99901586 AACAGCCCGAGTCTGTTTCCAGG + Intergenic
1195232011 X:102859603-102859625 ACAGCACCAAGTGTGTTTCCAGG + Intergenic
1195237052 X:102911107-102911129 ACAGCACCGAGTCTATTTCAGGG - Intergenic
1195538477 X:106035582-106035604 ACAGCCCTGGGTATGATTCCTGG - Intronic
1195795420 X:108642018-108642040 ACAGCCCCAAGTCTGTTTCCAGG - Intronic
1195972871 X:110492200-110492222 ACAGCACTGAGTTTATTTCCAGG + Intergenic
1195985161 X:110621688-110621710 ACAGCACCGAGTTTGTTTTCAGG + Intergenic
1196023976 X:111020782-111020804 ACAGCACCAAGTCTATTTCTAGG - Intronic
1196170865 X:112587412-112587434 ACAGCACTGAGTCTGTTTCCAGG - Intergenic
1196218866 X:113088192-113088214 ACAACCCTGAGTCTGTTTCCAGG - Intergenic
1196231928 X:113233843-113233865 ACAGCACCAAGTCTATTTCCAGG + Intergenic
1196235448 X:113274417-113274439 ACAGCCCCAAGTCTGTTTCCAGG - Intergenic
1196464790 X:115960685-115960707 ACAGCCCTGAGTCTATTTCCAGG - Intergenic
1196478051 X:116112076-116112098 ACAGCACTGAGTTTATTTCCAGG + Intergenic
1196519413 X:116655188-116655210 ACAGCACCGAGTTTTTTTCCAGG + Intergenic
1196530610 X:116782337-116782359 ATAGCACTGAATCTGTTTCCAGG - Intergenic
1196590524 X:117481709-117481731 ATAGCCCCAAGTCTGTTTCCTGG + Intergenic
1196675783 X:118419043-118419065 ACAGCCCCAAGTCTGTTTCCAGG + Intronic
1196737449 X:118992301-118992323 ACAGCTCCAAGTCTGTTTCCAGG - Intronic
1196948311 X:120850457-120850479 ACAGCACCAAGTCTGTTTCCAGG + Intergenic
1196966733 X:121064679-121064701 ACAGCACCAAGTTTGTTTCCAGG + Intergenic
1197034691 X:121859543-121859565 ACAGCACTAAGTCTATTTCCAGG + Intergenic
1197083494 X:122446273-122446295 ACAGCACCAAGTTTATTTCCAGG - Intergenic
1197120040 X:122880462-122880484 ACAGCACCCAGTCTATTTCCAGG - Intergenic
1197132366 X:123019946-123019968 ACAGCCCCGAGTCTGTTTCCAGG - Intergenic
1197363533 X:125536273-125536295 ACAGTACTGAGTGTGTTTCCAGG - Intergenic
1197393367 X:125895798-125895820 ATAGCACCAAGTCTATTTCCAGG + Intergenic
1197476341 X:126929802-126929824 ATAGCACTGAGTCTGTTTCCAGG + Intergenic
1197588878 X:128384036-128384058 ACAGCCCTGAGTCTGTTTCCAGG - Intergenic
1197664638 X:129210602-129210624 ACAGCACCGAGTCTGTTTCCAGG + Intergenic
1197671696 X:129284595-129284617 ACAGCTCCCTGTCCGTTTCCAGG + Intergenic
1197910646 X:131479578-131479600 ACAGCACCGAGTTTGTTTCCAGG - Intergenic
1198616405 X:138463136-138463158 ACAACACCAAGTCTGTTTCTAGG - Intergenic
1198797316 X:140410803-140410825 ACAGCACTGAGTTTATTTCCAGG + Intergenic
1198821214 X:140650476-140650498 ACAGCCCTGAGCCTGCCTCCAGG + Intergenic
1198943313 X:141982438-141982460 ACAGCACCAAGTTTATTTCCAGG + Intergenic
1199014994 X:142804629-142804651 ACAGCACCAAGTCTGTTTCCAGG + Intergenic
1199057898 X:143319284-143319306 ACACTCCCAAGCCTGTTTCCCGG + Intergenic
1199668483 X:150121066-150121088 ACAGCCCTGAGTCTGTTTCCAGG - Intergenic
1200332642 X:155313814-155313836 ACAGCACCGAGTCTATTTCTGGG - Intronic
1200616725 Y:5388031-5388053 ACAGTGCTGAGTTTGTTTCCAGG + Intronic
1201306670 Y:12556473-12556495 ACATCCCCCAGTATGTTTCCAGG - Intergenic
1201315773 Y:12643998-12644020 ACAGCACTGAGTCTGTTTCCAGG - Intergenic
1202036427 Y:20641412-20641434 ACAGCACCAAGTCTTTTTCCAGG + Intergenic
1202043690 Y:20714451-20714473 ACATCCCTGAGTTTGTTTCCAGG - Intergenic