ID: 1005072461

View in Genome Browser
Species Human (GRCh38)
Location 6:21874466-21874488
Sequence GGGGCTGTTTCCAGATATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005072459_1005072461 -8 Left 1005072459 6:21874451-21874473 CCTGGAAACAGACTCGGGGCTGT 0: 16
1: 106
2: 195
3: 242
4: 399
Right 1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG No data
1005072449_1005072461 26 Left 1005072449 6:21874417-21874439 CCAGGGCAAGTTTTCAAGCCCAT No data
Right 1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG No data
1005072455_1005072461 -2 Left 1005072455 6:21874445-21874467 CCTGCGCCTGGAAACAGACTCGG No data
Right 1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG No data
1005072448_1005072461 27 Left 1005072448 6:21874416-21874438 CCCAGGGCAAGTTTTCAAGCCCA No data
Right 1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG No data
1005072451_1005072461 8 Left 1005072451 6:21874435-21874457 CCCATCCTGCCCTGCGCCTGGAA No data
Right 1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG No data
1005072454_1005072461 -1 Left 1005072454 6:21874444-21874466 CCCTGCGCCTGGAAACAGACTCG No data
Right 1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG No data
1005072453_1005072461 3 Left 1005072453 6:21874440-21874462 CCTGCCCTGCGCCTGGAAACAGA No data
Right 1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG No data
1005072452_1005072461 7 Left 1005072452 6:21874436-21874458 CCATCCTGCCCTGCGCCTGGAAA No data
Right 1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005072461 Original CRISPR GGGGCTGTTTCCAGATATCA GGG Intergenic
No off target data available for this crispr