ID: 1005075289

View in Genome Browser
Species Human (GRCh38)
Location 6:21901116-21901138
Sequence CAGGACTTTCCCTTCTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005075289_1005075291 12 Left 1005075289 6:21901116-21901138 CCAACAGAGAAGGGAAAGTCCTG No data
Right 1005075291 6:21901151-21901173 TTTTAAACTTAAGCTGCTAGAGG No data
1005075289_1005075292 20 Left 1005075289 6:21901116-21901138 CCAACAGAGAAGGGAAAGTCCTG No data
Right 1005075292 6:21901159-21901181 TTAAGCTGCTAGAGGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005075289 Original CRISPR CAGGACTTTCCCTTCTCTGT TGG (reversed) Intergenic
No off target data available for this crispr