ID: 1005075770

View in Genome Browser
Species Human (GRCh38)
Location 6:21905393-21905415
Sequence ATCAGGTGCTTTAGGTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005075770_1005075775 18 Left 1005075770 6:21905393-21905415 CCCTTTTACCTAAAGCACCTGAT No data
Right 1005075775 6:21905434-21905456 ACCATCTATTGACACATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005075770 Original CRISPR ATCAGGTGCTTTAGGTAAAA GGG (reversed) Intergenic
No off target data available for this crispr