ID: 1005080219

View in Genome Browser
Species Human (GRCh38)
Location 6:21949579-21949601
Sequence CTGATTGCTTAGAGAGGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005080219_1005080225 10 Left 1005080219 6:21949579-21949601 CCATAACCTCTCTAAGCAATCAG No data
Right 1005080225 6:21949612-21949634 TGCAAGTCCTGGGAAAACCTGGG No data
1005080219_1005080222 -1 Left 1005080219 6:21949579-21949601 CCATAACCTCTCTAAGCAATCAG No data
Right 1005080222 6:21949601-21949623 GGCTTACATTTTGCAAGTCCTGG No data
1005080219_1005080224 9 Left 1005080219 6:21949579-21949601 CCATAACCTCTCTAAGCAATCAG No data
Right 1005080224 6:21949611-21949633 TTGCAAGTCCTGGGAAAACCTGG No data
1005080219_1005080223 0 Left 1005080219 6:21949579-21949601 CCATAACCTCTCTAAGCAATCAG No data
Right 1005080223 6:21949602-21949624 GCTTACATTTTGCAAGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005080219 Original CRISPR CTGATTGCTTAGAGAGGTTA TGG (reversed) Intergenic
No off target data available for this crispr