ID: 1005081061

View in Genome Browser
Species Human (GRCh38)
Location 6:21956930-21956952
Sequence TGTCATCCCAGTATTGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005081056_1005081061 10 Left 1005081056 6:21956897-21956919 CCTCATTGGTGTGGAGCCTGGGG No data
Right 1005081061 6:21956930-21956952 TGTCATCCCAGTATTGTGCAGGG No data
1005081050_1005081061 27 Left 1005081050 6:21956880-21956902 CCTCACCAGGAACACTGCCTCAT No data
Right 1005081061 6:21956930-21956952 TGTCATCCCAGTATTGTGCAGGG No data
1005081052_1005081061 22 Left 1005081052 6:21956885-21956907 CCAGGAACACTGCCTCATTGGTG No data
Right 1005081061 6:21956930-21956952 TGTCATCCCAGTATTGTGCAGGG No data
1005081059_1005081061 -6 Left 1005081059 6:21956913-21956935 CCTGGGGGCTGAGATCTTGTCAT No data
Right 1005081061 6:21956930-21956952 TGTCATCCCAGTATTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005081061 Original CRISPR TGTCATCCCAGTATTGTGCA GGG Intergenic
No off target data available for this crispr