ID: 1005083491

View in Genome Browser
Species Human (GRCh38)
Location 6:21980792-21980814
Sequence CAGAGCAGGGAGGAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005083491_1005083502 9 Left 1005083491 6:21980792-21980814 CCCACCTCCTCCTCCCTGCTCTG No data
Right 1005083502 6:21980824-21980846 TTCTCCTCCTTCCTGCACTGGGG No data
1005083491_1005083501 8 Left 1005083491 6:21980792-21980814 CCCACCTCCTCCTCCCTGCTCTG No data
Right 1005083501 6:21980823-21980845 CTTCTCCTCCTTCCTGCACTGGG No data
1005083491_1005083500 7 Left 1005083491 6:21980792-21980814 CCCACCTCCTCCTCCCTGCTCTG No data
Right 1005083500 6:21980822-21980844 CCTTCTCCTCCTTCCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005083491 Original CRISPR CAGAGCAGGGAGGAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr