ID: 1005083625

View in Genome Browser
Species Human (GRCh38)
Location 6:21981564-21981586
Sequence CAGAACAAGAAAGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005083625_1005083635 30 Left 1005083625 6:21981564-21981586 CCTGCCTCCTCTTTCTTGTTCTG No data
Right 1005083635 6:21981617-21981639 CTGCCTCCTCCTTCCTGCTTTGG No data
1005083625_1005083631 4 Left 1005083625 6:21981564-21981586 CCTGCCTCCTCTTTCTTGTTCTG No data
Right 1005083631 6:21981591-21981613 CCACCTCCTCTTTACTACTTTGG No data
1005083625_1005083632 5 Left 1005083625 6:21981564-21981586 CCTGCCTCCTCTTTCTTGTTCTG No data
Right 1005083632 6:21981592-21981614 CACCTCCTCTTTACTACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005083625 Original CRISPR CAGAACAAGAAAGAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr