ID: 1005083659

View in Genome Browser
Species Human (GRCh38)
Location 6:21981720-21981742
Sequence CAGAGTAGGAAGGAGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005083659_1005083671 30 Left 1005083659 6:21981720-21981742 CCTGCCGCCTCCTTCCTACTCTG No data
Right 1005083671 6:21981773-21981795 CTGCCTCCTCTTTGCTACTCTGG No data
1005083659_1005083666 4 Left 1005083659 6:21981720-21981742 CCTGCCGCCTCCTTCCTACTCTG No data
Right 1005083666 6:21981747-21981769 CTGCCTTCTCCTTCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005083659 Original CRISPR CAGAGTAGGAAGGAGGCGGC AGG (reversed) Intergenic
No off target data available for this crispr