ID: 1005084663

View in Genome Browser
Species Human (GRCh38)
Location 6:21992757-21992779
Sequence GAATCTGTGGTCAATCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005084663_1005084666 -3 Left 1005084663 6:21992757-21992779 CCTTTGAGATTGACCACAGATTC No data
Right 1005084666 6:21992777-21992799 TTCAAACCTTGCTAAAGGCTTGG No data
1005084663_1005084665 -8 Left 1005084663 6:21992757-21992779 CCTTTGAGATTGACCACAGATTC No data
Right 1005084665 6:21992772-21992794 ACAGATTCAAACCTTGCTAAAGG No data
1005084663_1005084668 5 Left 1005084663 6:21992757-21992779 CCTTTGAGATTGACCACAGATTC No data
Right 1005084668 6:21992785-21992807 TTGCTAAAGGCTTGGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005084663 Original CRISPR GAATCTGTGGTCAATCTCAA AGG (reversed) Intergenic
No off target data available for this crispr