ID: 1005089687

View in Genome Browser
Species Human (GRCh38)
Location 6:22043450-22043472
Sequence ATGTTTACAGATATCCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005089685_1005089687 4 Left 1005089685 6:22043423-22043445 CCCTGCTTGGGGAAGGGTGGTAG No data
Right 1005089687 6:22043450-22043472 ATGTTTACAGATATCCAGCCAGG No data
1005089681_1005089687 11 Left 1005089681 6:22043416-22043438 CCAGGCTCCCTGCTTGGGGAAGG No data
Right 1005089687 6:22043450-22043472 ATGTTTACAGATATCCAGCCAGG No data
1005089686_1005089687 3 Left 1005089686 6:22043424-22043446 CCTGCTTGGGGAAGGGTGGTAGA No data
Right 1005089687 6:22043450-22043472 ATGTTTACAGATATCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005089687 Original CRISPR ATGTTTACAGATATCCAGCC AGG Intergenic
No off target data available for this crispr