ID: 1005098953

View in Genome Browser
Species Human (GRCh38)
Location 6:22148268-22148290
Sequence TGCATTCCTGCGGATGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005098953 Original CRISPR TGCATTCCTGCGGATGGGGC TGG Intergenic
904039135 1:27574332-27574354 TCTATTCCTCAGGATGGGGCTGG + Intronic
906840597 1:49134480-49134502 TGCATTCCTGGGGTGGGGGGGGG - Intronic
911211834 1:95148316-95148338 TGCATTGATGCTGTTGGGGCTGG + Intronic
912174781 1:107141548-107141570 TGCATCGCAGCGGGTGGGGCGGG - Intronic
913303780 1:117401458-117401480 TTCATTCCTGTGGATTGGGGTGG + Intronic
914914445 1:151810271-151810293 GGCATTCATGGGGGTGGGGCAGG - Intronic
915276346 1:154791356-154791378 TACATTCTTGCGGCTGGTGCTGG + Intronic
915850124 1:159312928-159312950 TGCATTTCTGTGGATGTTGCAGG - Intergenic
917403526 1:174678885-174678907 TCCATCCCTCCGGATAGGGCAGG - Intronic
919880388 1:201897088-201897110 AGCATTCCTGCAGTTGGGGCAGG + Exonic
920297707 1:204969157-204969179 TGCATGCCCGTGCATGGGGCAGG + Intronic
920639845 1:207741472-207741494 TCCATTCCTCCGGATCCGGCAGG - Intergenic
922242792 1:223766996-223767018 TCCATTCCTGGGGCTGGTGCGGG + Intronic
922967899 1:229707222-229707244 TGCATTCCTGGGGGAGGGGGGGG + Intergenic
923256301 1:232224312-232224334 TGCATTCCAAGGGATGGGCCAGG - Intergenic
1063464821 10:6236307-6236329 TGCATCTCTGCAGATGGGGCAGG + Intergenic
1066381550 10:34906177-34906199 TGCCTTCCCTCGGATGGGGCTGG + Intergenic
1066501716 10:36001319-36001341 TGAATTCCTGCAGATGGGGAAGG - Intergenic
1066629561 10:37445678-37445700 TGAATTCCTGCAGATGGGGAAGG - Intergenic
1067444340 10:46331217-46331239 TGCATTCCAGTAGATGGGGGAGG - Intergenic
1068648207 10:59492894-59492916 TGTATCCCTGCAGCTGGGGCAGG - Intergenic
1069757545 10:70782395-70782417 TACATCCCTGGGGATGGGGATGG + Intronic
1069962645 10:72087738-72087760 AGCATCCCAGCGGCTGGGGCAGG + Intronic
1073062612 10:100741523-100741545 GGCCTTTCTGCGGAAGGGGCTGG + Intronic
1073719685 10:106153336-106153358 TGGATTCCTGCAGATTTGGCAGG + Intergenic
1073925057 10:108505475-108505497 TGCATTCCTTTGGAGGGGGAGGG - Intergenic
1075659680 10:124184691-124184713 TCCATTCTAGTGGATGGGGCTGG + Intergenic
1075745882 10:124727262-124727284 TGCCTTCCTGAGGCTGAGGCAGG - Intronic
1076000296 10:126907551-126907573 TGCTTGCCTGCAGATGGGGAGGG + Intronic
1077225289 11:1436821-1436843 TGCAGGGCTGCGGGTGGGGCAGG + Intronic
1078395828 11:10981080-10981102 TGTATTCTTGAGAATGGGGCAGG + Intergenic
1078515445 11:12018089-12018111 TGCCTTCCTGTGGATGTGGTTGG + Intergenic
1079601737 11:22317895-22317917 TCCATCCCTCCGGATGCGGCAGG - Intergenic
1080457971 11:32432351-32432373 TGCATTCCTGGGGAAGCAGCAGG + Intronic
1080799759 11:35599298-35599320 TGCAGTCCTGCACATGGGGATGG + Intergenic
1081537209 11:44004692-44004714 TGCATCTCTGAGGATAGGGCGGG - Intergenic
1081611005 11:44563422-44563444 TGCATTCCACAGGATGGGCCGGG + Intergenic
1087276689 11:96167978-96168000 TGAGCTCCTGCGGTTGGGGCTGG + Intronic
1087364422 11:97201248-97201270 TGCTTTCCTGCTGATCTGGCGGG - Intergenic
1088161763 11:106880264-106880286 TGCATTCCACAGGATGGGTCAGG - Intronic
1088558849 11:111091724-111091746 TGCATTCCTGCAGAAGAGCCAGG - Intergenic
1089647749 11:119891422-119891444 TGCCTTCGTGCAGATGGGGCTGG + Intergenic
1089792260 11:120953628-120953650 TGGTTTCCTGGGGATAGGGCAGG - Intronic
1091664856 12:2411775-2411797 AGCAATCCTGAGGATGGGGGAGG - Intronic
1093022176 12:14213997-14214019 TGCTATCCTGGGGCTGGGGCAGG - Intergenic
1093678602 12:21973700-21973722 TGCATATCTGCAAATGGGGCTGG + Intergenic
1093744057 12:22719819-22719841 TGCATTCCTGAGATTGGTGCTGG - Intergenic
1094063511 12:26340139-26340161 TGCATTCAGGGAGATGGGGCTGG - Intronic
1096521235 12:52185899-52185921 TGCCTGCCTGGGGCTGGGGCGGG + Intronic
1098613069 12:72485681-72485703 TGCATCCCTTTGTATGGGGCAGG - Intronic
1102354695 12:112222946-112222968 TGCATTCATGAGGCTGGGGAGGG + Intronic
1102888401 12:116538841-116538863 TGAATTCCTGCAGCAGGGGCGGG - Intergenic
1103885380 12:124196524-124196546 GGCAGTTCTGCTGATGGGGCTGG + Intronic
1104031786 12:125070044-125070066 TGCATTCCATGGGATGGGCCGGG - Intronic
1105434424 13:20364418-20364440 TGCGTTCCTGCTGCTCGGGCTGG - Intergenic
1106305261 13:28504038-28504060 TCCAGTCCAGAGGATGGGGCTGG - Intergenic
1107119187 13:36778821-36778843 TCCACTCCTCCTGATGGGGCAGG + Intergenic
1107346124 13:39462860-39462882 TTCATTCTTCGGGATGGGGCTGG + Intronic
1107869329 13:44732667-44732689 TCCATTCCTCAGGGTGGGGCCGG - Intergenic
1109181357 13:59217774-59217796 TGCATCCCTGAGGCTGGGCCAGG + Intergenic
1112169881 13:96960309-96960331 TGCATTTTTGTGGATGGGGAAGG - Intergenic
1112802820 13:103131562-103131584 TGCAGTCCGGGGGATGGGGGTGG - Intergenic
1114631960 14:24164848-24164870 TGCATTCCAGGAGATGGGGATGG - Exonic
1116070060 14:40032427-40032449 TGCTTTCCTGAGGATGAGTCAGG - Intergenic
1116848647 14:49887513-49887535 TGTATTTCTGTGGATGGGGGCGG + Intergenic
1118311954 14:64700311-64700333 TGGTTTCCTGGGGCTGGGGCTGG - Intergenic
1122184895 14:99984421-99984443 TTCATCCTTGGGGATGGGGCTGG - Intronic
1122353471 14:101110584-101110606 TGCCTTCCTGCGAAAGGGTCCGG - Intergenic
1122814445 14:104305585-104305607 TGGGCTGCTGCGGATGGGGCGGG + Intergenic
1124649022 15:31461412-31461434 TGCATTCCAAGGGATGGGCCAGG + Intergenic
1126663234 15:51052457-51052479 TGCATGCCAGCAGATGAGGCTGG + Intergenic
1126890191 15:53196887-53196909 TGCTTTCCTGAGGCTTGGGCAGG - Intergenic
1132666492 16:1083421-1083443 GGCACCCCTGCTGATGGGGCTGG - Intergenic
1132692659 16:1188545-1188567 TGCATTCCCGCGGCTGGGTGAGG - Intronic
1134123967 16:11603665-11603687 TGCATGCCTGCTGAGGTGGCCGG - Intronic
1136120682 16:28131480-28131502 TGCATAGCAGCTGATGGGGCAGG + Intronic
1137607957 16:49799416-49799438 GGCATTCCTGTGGGTGGGGCGGG - Intronic
1137686447 16:50390256-50390278 TGCCTTCCTGCAGAAGGGACAGG - Intergenic
1137907162 16:52334486-52334508 TGCATTCCTTTGGAGGGGGAGGG - Intergenic
1140203956 16:72918288-72918310 TGCATTCAGGAGGATGGGGACGG + Intronic
1140651409 16:77092510-77092532 TGAATTCCAGCTGATGCGGCGGG + Intergenic
1143106803 17:4534230-4534252 GGCGTGCCTGCGGCTGGGGCTGG + Intronic
1144334036 17:14253148-14253170 TTCATATCTGCTGATGGGGCTGG - Intergenic
1145193524 17:20867757-20867779 TGCATTGCTGGTGGTGGGGCAGG - Intronic
1145264207 17:21371762-21371784 TGCCTGCCTCCTGATGGGGCAGG + Intergenic
1145298494 17:21613323-21613345 TGCATTGCTGGTGGTGGGGCAGG + Intergenic
1145652401 17:26176313-26176335 AACATTCCTTCGGATGGAGCAGG + Intergenic
1147806466 17:43135255-43135277 TGCAGGCCTGCGGATCGGCCAGG - Intergenic
1147921088 17:43917542-43917564 TGCAGACCTGCGGATCGGCCAGG - Exonic
1148823272 17:50373293-50373315 CGCAGGCCTGCGGATTGGGCAGG + Intronic
1149419813 17:56499056-56499078 TGCATCTCTGGGGATGGGGGTGG - Intronic
1149524855 17:57347474-57347496 TGAACACATGCGGATGGGGCTGG - Intronic
1150847500 17:68674663-68674685 TACATACGTGCTGATGGGGCTGG + Intergenic
1152098845 17:78289237-78289259 TTCATGCCTGGGGCTGGGGCAGG - Intergenic
1152288675 17:79426493-79426515 TTCCTTCCAGCCGATGGGGCAGG + Intronic
1155923482 18:31629270-31629292 TGCATTCCGGTGGCTGGGGGAGG + Intronic
1155958087 18:31970823-31970845 TGCATACGTGGGGGTGGGGCAGG - Intergenic
1158335038 18:56406863-56406885 TACATACCAGCTGATGGGGCTGG + Intergenic
1159028168 18:63205848-63205870 TGGAGGCCTGGGGATGGGGCCGG - Intronic
1160410586 18:78673174-78673196 TGCTTTCCCGAGGGTGGGGCTGG - Intergenic
1162565983 19:11446102-11446124 TGGAGTCCTGAGGAGGGGGCAGG + Intronic
1163862555 19:19749862-19749884 TGCATTCCGGGGTAGGGGGCTGG - Intergenic
1164595090 19:29526986-29527008 TGCTTCCCTCCGGATGGGGCGGG - Intronic
1164628628 19:29746488-29746510 TGCAGCCCTGCGGGTGGGTCTGG + Intergenic
1166874588 19:45889948-45889970 TGCCTGCCTGTGGAGGGGGCGGG + Intergenic
1168288940 19:55347694-55347716 TGCAGTCCTGAGGCTGGGGCAGG - Exonic
925046884 2:778953-778975 TACATTCCTGGGGGTGGGGATGG - Intergenic
926325989 2:11785519-11785541 TGCATTGCTACGAATGTGGCAGG - Intronic
931909768 2:66886121-66886143 TGAGTTACTGCAGATGGGGCTGG + Intergenic
932056105 2:68445759-68445781 TGCAGTGCTGGGGCTGGGGCAGG + Intergenic
932474289 2:71991824-71991846 TGTATTCCCATGGATGGGGCTGG - Intergenic
932490111 2:72114910-72114932 TGCATTCCTGAGACAGGGGCTGG - Intergenic
934550862 2:95260754-95260776 AGCATTCTTGCAGATGAGGCAGG - Intergenic
936328260 2:111524037-111524059 TGCATAGCTGGAGATGGGGCAGG + Intergenic
945889638 2:215414882-215414904 TGCATTCCACTGGATGGGGTGGG + Exonic
946155692 2:217805173-217805195 TCCAGTCCTGCGGGTGGGGGTGG - Intronic
946333993 2:219025578-219025600 TGATCTCCTGAGGATGGGGCTGG + Intronic
948005275 2:234603236-234603258 TGCATGCCTGGGGAAGAGGCTGG - Intergenic
1171178698 20:23075298-23075320 TGCATTTCTGCTGATGCTGCTGG - Intergenic
1171185513 20:23121548-23121570 AGCAGTCCTGGGGGTGGGGCGGG - Intergenic
1173916165 20:46709890-46709912 TGCAGGCCTGCGGCGGGGGCTGG + Intronic
1174037956 20:47679624-47679646 TGCGTCCCTGCTCATGGGGCAGG - Intronic
1175166297 20:57047101-57047123 TGCATTCCTGAGGCTGGGGGTGG - Intergenic
1176649235 21:9530386-9530408 TGCATTGCTGGTGGTGGGGCAGG + Intergenic
1178428186 21:32496164-32496186 TGGTTGCCTGGGGATGGGGCAGG - Intronic
1179641838 21:42752862-42752884 AGCAGGCCTGCTGATGGGGCCGG - Intronic
1182147135 22:28003485-28003507 TGCAGGCCTGGGGCTGGGGCTGG - Intronic
1182280232 22:29214191-29214213 TGCATGCTGGCGGAGGGGGCAGG + Intronic
1182869696 22:33635195-33635217 TGCATTCCAGGGAATGGGCCAGG - Intronic
1184244015 22:43226859-43226881 AGCATGCCTGCAGAGGGGGCAGG + Intronic
950482881 3:13255370-13255392 TGTATTGCTATGGATGGGGCTGG + Intergenic
950499679 3:13355705-13355727 TGCATGCCTGCTGATGGTGCTGG - Intronic
953194931 3:40723288-40723310 TCCCTCCCTGCAGATGGGGCAGG - Intergenic
956891963 3:73622454-73622476 TGCCTTCCTGGGGAGGGGCCTGG - Intronic
957687049 3:83515333-83515355 TCCATCCCTCCGGATGCGGCAGG + Intergenic
958810534 3:98856449-98856471 TGTATTTCTGTGGATAGGGCTGG - Intronic
959395330 3:105830111-105830133 TGCATTACTGGGGCAGGGGCAGG - Intronic
962224843 3:133597243-133597265 TGCATTCCAAGGAATGGGGCAGG + Intergenic
968503936 4:963399-963421 CGCCTTCCTGGGGAGGGGGCTGG - Intronic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
969516625 4:7651779-7651801 TGCATTCCAAGGGATGGGCCAGG + Intronic
970095533 4:12459591-12459613 TCCATCCCTGCGGATCCGGCAGG + Intergenic
970902201 4:21172945-21172967 TGCAGTCCTGGGGATGAGGTTGG - Intronic
972302586 4:37799140-37799162 TCAATTCCTGGGGATGGTGCTGG - Intergenic
979503616 4:121468134-121468156 TGCATTCCTGGGGGGGGGGGGGG - Intergenic
989080936 5:37620337-37620359 TGCATTGATGCTCATGGGGCAGG + Intronic
990001439 5:50898018-50898040 TGGTTTCCTGGGAATGGGGCAGG - Intergenic
992413642 5:76532463-76532485 TGCTTTCCTGAGGATTGGGTGGG + Intronic
993550885 5:89272525-89272547 TGCATTCCTCCGGCTTGTGCTGG + Intergenic
994225523 5:97248019-97248041 TGTATTCCTGCGGATTGGTGTGG + Intergenic
994750926 5:103736049-103736071 TGCATTCCTGCCGAAGGCTCTGG + Intergenic
996249561 5:121312325-121312347 TGCATTCGTTCTGATGGGGAGGG - Intergenic
997435047 5:133867852-133867874 TGCAGGCCTGAGGATAGGGCAGG - Intergenic
998122118 5:139587294-139587316 TCCATCCCTCCGGATGGAGCAGG - Intronic
998507835 5:142686304-142686326 TGCATCCCTGCGGGTGGTGTGGG - Intronic
999200115 5:149810321-149810343 TGCCTTCCTGGGCCTGGGGCAGG + Intronic
1000343589 5:160295924-160295946 AGAATTCCTGGGGATGGAGCTGG + Intronic
1001568338 5:172714640-172714662 TGCAGCCGTGGGGATGGGGCAGG - Intergenic
1005098953 6:22148268-22148290 TGCATTCCTGCGGATGGGGCTGG + Intergenic
1006410227 6:33869311-33869333 TCCTTTGCTGGGGATGGGGCTGG + Intergenic
1006782879 6:36644000-36644022 TGCATTCCTGGGGATGCAGCTGG + Intergenic
1007090048 6:39178450-39178472 TGTATTCCTGGGGATGGGAGTGG - Intergenic
1007696880 6:43739829-43739851 TGCATCCCTGTGGAGTGGGCTGG + Intergenic
1007892152 6:45305752-45305774 TGCAGTTCTGGGGTTGGGGCAGG - Intronic
1010581717 6:77607154-77607176 TCCATTCCTGCAGTCGGGGCTGG - Intergenic
1013775011 6:113669843-113669865 TGCTATCCTGCAGTTGGGGCTGG - Intergenic
1015770288 6:136761634-136761656 GGCAACCCTGCGGCTGGGGCTGG + Intronic
1016650519 6:146455245-146455267 TGCTTTTCTGGGGAAGGGGCAGG - Intergenic
1019350219 7:551062-551084 AGCATTCCTGCAGCTGGGGGTGG - Intronic
1025023773 7:55499468-55499490 TGCTTTCCTGAGGGTGGAGCAGG + Intronic
1025275773 7:57580441-57580463 TGCATTGCTGGTGGTGGGGCAGG + Intergenic
1028298665 7:89169134-89169156 TTCACTCCTCCGGATGGGGCAGG - Intronic
1028536619 7:91895054-91895076 TGAATTCCTGGGGATGGTGAAGG + Intergenic
1030082456 7:105789504-105789526 TGCTTCCCTGAGGAGGGGGCAGG + Intronic
1033621904 7:143069423-143069445 TCCCTTCCTGAGGCTGGGGCTGG - Intergenic
1035548983 8:505620-505642 TGCGTTCCTGCTGCTGTGGCTGG - Intronic
1036522210 8:9502000-9502022 TGGATGCCAGAGGATGGGGCTGG - Intergenic
1037596045 8:20354924-20354946 GGCACCCCTGCGGATGGGGCAGG + Intergenic
1040605038 8:48923388-48923410 CGGATACCTGCTGATGGGGCTGG - Intergenic
1043697605 8:83240339-83240361 TGCCCTCCTGCTGATGGGGTGGG + Intergenic
1043871476 8:85438496-85438518 TGCATTCTTGGGGATGGGGTGGG - Intronic
1047436984 8:124842960-124842982 GGCATTTCTGCAGCTGGGGCTGG + Intergenic
1048364925 8:133730247-133730269 TCCATTCCTGCGGAGGAGGGTGG + Intergenic
1049232502 8:141491788-141491810 TCCACTCCTGCGGAATGGGCAGG + Intergenic
1056450846 9:86715527-86715549 TGCATGCATGGGGAGGGGGCTGG + Intergenic
1056587630 9:87938751-87938773 TGCATTGCTGGTGGTGGGGCAGG - Intergenic
1056609241 9:88114188-88114210 TGCATTGCTGGTGGTGGGGCAGG + Intergenic
1057381271 9:94569526-94569548 TCCACTCCTGGGGCTGGGGCCGG + Intronic
1057742309 9:97722482-97722504 TGCATTCCTGATCAAGGGGCAGG - Intergenic
1057875514 9:98751235-98751257 TGGACTCCTGCAGATGAGGCTGG + Intronic
1058309553 9:103484038-103484060 TGCACTCCTGTTGATGGGACCGG - Intergenic
1059023297 9:110598934-110598956 TCCACTCCTGCTCATGGGGCAGG - Intergenic
1061318546 9:129813439-129813461 GGCATCCCTGGGGATGTGGCTGG - Exonic
1061567786 9:131455180-131455202 TGCACTCATGCTGATAGGGCAGG - Intronic
1062383197 9:136297618-136297640 TTCATTTCTGGGGCTGGGGCTGG - Intronic
1062419463 9:136472880-136472902 TGCACTCCTGCGGAGGGAGGTGG + Intronic
1203626974 Un_KI270750v1:33934-33956 TGCATTGCTGGTGGTGGGGCAGG + Intergenic
1190253853 X:48747856-48747878 TGCATTCCTGGGAATGTGGGAGG - Intergenic
1191874710 X:65784471-65784493 AGGATTCCCTCGGATGGGGCAGG + Intergenic
1194922973 X:99790526-99790548 TGCATTCCTGAGGTTTGGGTAGG + Intergenic
1196097369 X:111814698-111814720 TTCATGCCTGAGGATGGGGATGG - Intronic
1196365146 X:114915284-114915306 TTCTTTCCTGGGTATGGGGCAGG - Intergenic
1198729188 X:139709081-139709103 TGGTTTCCAGAGGATGGGGCAGG - Intergenic