ID: 1005104636

View in Genome Browser
Species Human (GRCh38)
Location 6:22210631-22210653
Sequence ACCTAGGAGAAACTACATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005104634_1005104636 -5 Left 1005104634 6:22210613-22210635 CCAAGCAAGAGTATCGGCACCTA No data
Right 1005104636 6:22210631-22210653 ACCTAGGAGAAACTACATCTAGG No data
1005104632_1005104636 4 Left 1005104632 6:22210604-22210626 CCATGAATTCCAAGCAAGAGTAT No data
Right 1005104636 6:22210631-22210653 ACCTAGGAGAAACTACATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005104636 Original CRISPR ACCTAGGAGAAACTACATCT AGG Intergenic
No off target data available for this crispr