ID: 1005111670

View in Genome Browser
Species Human (GRCh38)
Location 6:22288562-22288584
Sequence CAGCAACCCTTCAGTGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005111670 Original CRISPR CAGCAACCCTTCAGTGGTGA GGG Intronic
900165077 1:1241293-1241315 CAGCACCCCTTCTGTGGGCACGG - Intergenic
900208210 1:1440479-1440501 CAGGAAACCTTCCGTCGTGAGGG + Exonic
900542967 1:3213211-3213233 CACCACCCATTCCGTGGTGAGGG + Intronic
902330852 1:15730635-15730657 CAGCATGCCTTCTTTGGTGATGG - Exonic
903438948 1:23372669-23372691 CAGCAGCCCTGCAGTCGTGAGGG - Intergenic
904534180 1:31188318-31188340 CAGCATCCCTTTGGTAGTGAAGG - Intronic
905350428 1:37342353-37342375 CAGTCACCCTTCCTTGGTGAGGG - Intergenic
909517695 1:76531071-76531093 CAGCCACCCTTGAGGGTTGAGGG - Intronic
909530460 1:76676111-76676133 CAAAAATCCTTCAGTGATGAAGG + Intergenic
911166375 1:94728326-94728348 CAGCAAGCCATCAGTGGAGGAGG + Intergenic
913340962 1:117757903-117757925 CAGGAGTCCTTCAGAGGTGATGG + Intergenic
915312453 1:155011378-155011400 CACCTACCCTTCAGTGCTCAAGG - Intronic
922977586 1:229798359-229798381 CACCAACCTTTCTGTGGAGATGG + Intergenic
923323135 1:232856406-232856428 CTCCAACTCTTCAGGGGTGAGGG + Intergenic
923778680 1:237002147-237002169 CAGCAACAGGTCAGTGATGAAGG - Intergenic
924274801 1:242374939-242374961 CAGCAAAGCTTCAGGGGTCAAGG + Intronic
1064035376 10:11909668-11909690 CAGGAACCCTCCAGTGAGGACGG + Intergenic
1064832387 10:19484931-19484953 CAGCAACCCATGAGTGGATAAGG + Intronic
1065821476 10:29529716-29529738 GACCACCTCTTCAGTGGTGATGG + Exonic
1068607639 10:59023865-59023887 CAGAAACCCTGGAGTGGAGATGG - Intergenic
1068706168 10:60078506-60078528 GAGCCAGCCTTCAGTGGTAAAGG - Intronic
1071087281 10:81877459-81877481 CATTAACTCTTCAGTGATGATGG + Intronic
1077128051 11:953015-953037 CAGCACCCCTGCAGTCATGACGG - Intronic
1083924972 11:65800581-65800603 CAGGCACCCATCAGTGGTGCAGG + Intergenic
1084302634 11:68261474-68261496 CAGCAACTCTTTAGTGATCATGG + Exonic
1089603270 11:119627675-119627697 CAGCACCCCTTCTTTGGCGAGGG + Intronic
1091296123 11:134475146-134475168 GAGCAACCAGCCAGTGGTGAGGG - Intergenic
1093385853 12:18552187-18552209 CTGCAAACCCTCAGTGGTGCAGG - Intronic
1094108107 12:26833917-26833939 TAGCCAACCTTCAGCGGTGAGGG + Intergenic
1094213130 12:27913393-27913415 CATCAGCCCTTCAGTCATGAAGG + Intergenic
1098387492 12:69934481-69934503 CAGCTGCCCTCCACTGGTGAAGG + Intronic
1100019922 12:90056999-90057021 CAGAAACCCAGAAGTGGTGATGG + Intergenic
1104307397 12:127621800-127621822 CAGCTGCCCTCCACTGGTGAGGG + Intergenic
1107299357 13:38948783-38948805 CAGGAAACCTGCAGAGGTGAGGG + Intergenic
1112849831 13:103691751-103691773 CAGACACCCTTAAGTGGTGAGGG + Intergenic
1113185665 13:107683560-107683582 CAGGAAGCCTGCAGTGGGGACGG + Intronic
1113957179 13:114105152-114105174 CACCCACCCTTCTGAGGTGACGG - Intronic
1117439239 14:55744787-55744809 CAGCACCCTTTCAGAGGTGACGG + Intergenic
1123935461 15:25191942-25191964 CTGCAGCCCTGCAGTGATGACGG + Intergenic
1125733301 15:41906558-41906580 CGGCTACCCTGCAATGGTGAGGG - Intronic
1129041503 15:72690701-72690723 CAGGAACCCTTCTGGAGTGATGG - Intronic
1133904962 16:10013702-10013724 AAGAAACACTTCAGTGGTCATGG - Intronic
1134684727 16:16150527-16150549 CAGCAGCCCTGCAGTGGTGGGGG - Intronic
1135604237 16:23809351-23809373 CAGCAACCCTTGACAGATGAAGG + Intergenic
1136180907 16:28551262-28551284 CAGCAACATTTCAGTTATGATGG - Intergenic
1142069420 16:88082832-88082854 CAGCAACTCTGCATTGGTGATGG - Intronic
1147252356 17:39160584-39160606 CACTAACCCTTCCCTGGTGAGGG + Exonic
1147533523 17:41302259-41302281 TGTCAACCCGTCAGTGGTGAAGG - Exonic
1152135474 17:78500818-78500840 CAGAAAACCTTCAGGTGTGAAGG + Intronic
1152150876 17:78600236-78600258 CAGCCACCCCTAAGGGGTGAAGG + Intergenic
1152264173 17:79284241-79284263 CAGCAACCCTGCATTGGAAACGG - Intronic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1153498929 18:5728743-5728765 CAGCAAGCCTGCTGGGGTGAAGG + Intergenic
1156946888 18:42844293-42844315 CAGCTGCCCTCCACTGGTGAGGG + Intronic
1159437009 18:68431412-68431434 CAGCAACTTCTCAATGGTGATGG - Intergenic
1159739353 18:72146539-72146561 CAGAAAACCTTCAGAGGTGATGG + Intergenic
1161470447 19:4454385-4454407 CAGCACCCCTCCTGAGGTGAAGG + Intronic
1162084984 19:8243234-8243256 CAGATACCCTGCAGTGGTCATGG + Intronic
1168122790 19:54262228-54262250 CAGCATCCTTTCACTGCTGAGGG + Intronic
925660192 2:6194237-6194259 CAGAAAACCCTCAGTGGGGAAGG + Intergenic
926886991 2:17606963-17606985 CAGCTAACTTTCAATGGTGAGGG + Intronic
927019333 2:19000736-19000758 CAGCAGCCCTTCTGTGGGGCTGG - Intergenic
928203577 2:29267752-29267774 CAGCAAAGCTTCAGTGGTTTTGG - Intronic
934665217 2:96164751-96164773 CAGCAGCCCTTCCCTGGTGGCGG + Intergenic
934980201 2:98833287-98833309 CAGCAAGCCTGCAGAGGGGAGGG + Intronic
936574720 2:113643469-113643491 CAGCTACCCTTCATTGATAAGGG - Intergenic
937922237 2:127138533-127138555 CAGCAACTCTTCCGGGGCGAGGG + Intergenic
938999728 2:136720476-136720498 CAGCAACCTTTCTAGGGTGATGG - Intergenic
942728423 2:179036251-179036273 CATCAACACTTCATTGGTTATGG + Intronic
944208293 2:197180201-197180223 CAGCAAATATTCAGTGATGAAGG - Intronic
945062509 2:205921576-205921598 CAGCAGCCCTGCCCTGGTGATGG + Intergenic
946097188 2:217285211-217285233 TAGCAACACTTCAGTGGTGTTGG - Intronic
1175756773 20:61535272-61535294 CAGCAGCCCTACAGTGGGGCAGG + Intronic
1175953614 20:62596741-62596763 CTGCCACCCTTCTGTGGTGCCGG + Intergenic
1180226072 21:46393227-46393249 CAGCACCACTTCACTGGTGGAGG - Intronic
1180966120 22:19788766-19788788 CAGCAAGCCATCGGCGGTGAAGG + Exonic
1181862203 22:25827788-25827810 CAGCTGCCCTTCACTGGTGAAGG - Intronic
1183577944 22:38704096-38704118 CAGCAACCCATCAGTGCTGCAGG + Intergenic
950303870 3:11903739-11903761 CATCAACCCTTCAGGAGTGGGGG - Intergenic
950454641 3:13085419-13085441 CAGGAACCCTTCAGTGCGTAGGG + Intergenic
951828060 3:26890425-26890447 CATCAACCCTTCAGTGCTCAAGG - Intergenic
952530802 3:34259953-34259975 CAGCAACACTTCTGTGCAGAGGG - Intergenic
954772465 3:52984229-52984251 GAACAAACCTTTAGTGGTGAGGG - Intronic
955125355 3:56105610-56105632 CAGGAACCCTCCAGTGGGGCTGG - Intronic
956649834 3:71494434-71494456 CAGCACATCTTCAGTGTTGATGG - Intronic
957219100 3:77359525-77359547 CAGCAAGCCTTCATTTTTGAAGG - Intronic
961160154 3:124717349-124717371 GTGCAACCCTGCAGTTGTGAAGG - Intronic
963851109 3:150211211-150211233 CAAAAACCCCTAAGTGGTGATGG - Intergenic
965341935 3:167502198-167502220 CAGAAACCTTACAGTGGTGGTGG - Intronic
966804729 3:183798139-183798161 CAGCCACCCTTCAGCTGTCACGG + Intronic
966804736 3:183798181-183798203 CAGCCACCCTTCAGCTGTCATGG + Intronic
967020969 3:185522291-185522313 CAACAACACTTCAGTAATGAGGG - Intronic
967268450 3:187713106-187713128 CTGCTCCCCTTCAGTGCTGAGGG - Intronic
968628224 4:1637577-1637599 CAGGAGCCCTGCAGTGGGGAAGG + Intronic
968678506 4:1899380-1899402 CCGCAACCCATCAGAGGTCAGGG + Exonic
970265560 4:14280181-14280203 CTGTTAACCTTCAGTGGTGAAGG - Intergenic
973879656 4:55256525-55256547 CAGAGTCCCTTCATTGGTGAGGG - Intergenic
975026834 4:69559383-69559405 CAGCAAATTTACAGTGGTGATGG + Intergenic
977325938 4:95574948-95574970 CAGCAACCCAACAGAGTTGATGG - Intergenic
982975152 4:162047410-162047432 CATGAACCCTCCAGTTGTGAGGG - Intronic
985589567 5:757537-757559 CAGCAGCCCTTCCCTGATGAGGG + Intronic
986403094 5:7397719-7397741 CAGCTACCATTGAGTGGTGTGGG - Intronic
986762143 5:10889878-10889900 CAGCATTCCTTCAGTGCTCATGG + Intergenic
987486460 5:18533139-18533161 CAGCTGCCCTCCACTGGTGAGGG - Intergenic
990740617 5:58908838-58908860 GAGGGACCCCTCAGTGGTGAGGG + Intergenic
992207439 5:74444667-74444689 CAGGGACCCTTCCCTGGTGAGGG + Intergenic
993593983 5:89829652-89829674 CAGCAGGTCTTCAGTGATGAGGG - Intergenic
999071542 5:148748744-148748766 AAGCAACCCTTCAGGGGGGATGG - Intergenic
999914083 5:156238376-156238398 CATCCACCCTCCAGTGGTGTCGG + Intronic
1001145289 5:169178433-169178455 CAGCAACCGTTCAGTGTGTAAGG - Intronic
1001300661 5:170531363-170531385 CAGCAAAACTTAAGTGGAGAAGG - Intronic
1002028212 5:176409926-176409948 CTGCCTCCCGTCAGTGGTGAGGG + Intronic
1003884706 6:10511188-10511210 CAGCAAACCTTCTCTGGTAAAGG + Intronic
1003974541 6:11329894-11329916 GAGCAACCCTGCACTGGGGAGGG + Intronic
1005111670 6:22288562-22288584 CAGCAACCCTTCAGTGGTGAGGG + Intronic
1005493613 6:26369635-26369657 CAGCAATCCCTCATTGCTGAGGG + Intronic
1005498172 6:26406980-26407002 CAGCAATCCCTCATTGCTGATGG + Intronic
1007284973 6:40741109-40741131 CAGCAGCCCTCCATTGCTGATGG + Intergenic
1014186853 6:118444936-118444958 CAGCATACTTTCAGTGGTGGTGG - Intergenic
1016323134 6:142870049-142870071 GCGCAGCCCTTCAGTGGTCACGG - Intronic
1016434528 6:144022412-144022434 CAACAATCCATCATTGGTGATGG + Intronic
1017813888 6:158003055-158003077 CAGAAACCCATCTGTGGGGAGGG - Intronic
1019286874 7:228084-228106 CAGCGACCCGTCAGAGCTGATGG + Exonic
1021371995 7:19860700-19860722 GTGCAACCCTTCAGTCGGGAGGG - Intergenic
1023880031 7:44313104-44313126 CAGGAGCCCATCAGGGGTGATGG - Intronic
1030636245 7:111952423-111952445 AAGTAACCCTTCAGTTGGGAAGG + Intronic
1031870688 7:127087194-127087216 CTGGAACCCTGCAGTGGAGAAGG - Intronic
1035838806 8:2788313-2788335 CAGCAATCCTGCAGCAGTGAGGG - Intergenic
1038547235 8:28435035-28435057 CAGCTGCCCTCCACTGGTGAGGG + Intronic
1039302294 8:36222397-36222419 CAGCAAACCATCAGTGGTGAAGG + Intergenic
1041131931 8:54710489-54710511 CAGCTGCCCTCCACTGGTGAGGG + Intergenic
1049380174 8:142308937-142308959 CAGCAACCCCTCCGTGGTTTAGG + Intronic
1050108923 9:2194726-2194748 CACCAACCCAGCAGTGTTGAAGG - Intergenic
1057697024 9:97330481-97330503 CAGCACCTCTTCAGTTATGAAGG - Exonic
1060433496 9:123571416-123571438 CAACCAACCTTCTGTGGTGAAGG - Intronic
1060966588 9:127715291-127715313 GAGCAACGCTGCAGTGGGGAAGG + Intronic
1061274852 9:129564024-129564046 CAGCAAACCTTCAAGGGTGAAGG + Intergenic
1062338799 9:136084333-136084355 CAGCAACCCGCCTTTGGTGAAGG - Intronic
1062507517 9:136885829-136885851 CTGCAACCGGACAGTGGTGACGG - Intronic
1185831643 X:3308875-3308897 CAGGAACCCTCCAGTGGGGAAGG - Exonic
1186134568 X:6505542-6505564 CAGCAAAACTTCAGAGGAGAAGG - Intergenic
1186186434 X:7025014-7025036 TAGCAACGCCTCAGAGGTGATGG + Intergenic
1188385493 X:29552312-29552334 CAGCAAACCTTCACAGGTGAAGG + Intronic
1189669440 X:43392285-43392307 CAACAAACCTTCAGTGGGTAGGG + Intergenic
1193853921 X:86574759-86574781 CAGCAATGTTTCAGTGGAGAAGG + Intronic
1196246840 X:113409964-113409986 CAGCCACCCTTGGATGGTGAGGG - Intergenic
1197701541 X:129603952-129603974 CCCCAAGCCTTCAGTGGTGAAGG - Intergenic
1199641771 X:149869074-149869096 CAGCAACCCTTCCCTGGTCATGG - Intergenic
1200062681 X:153490575-153490597 CAGAGACCCTTGAGTGGTGATGG + Intronic
1201244355 Y:11988253-11988275 CAGCAACCCTGCACTGGGGAAGG + Intergenic