ID: 1005116181

View in Genome Browser
Species Human (GRCh38)
Location 6:22340089-22340111
Sequence CAAATTGTCCAGAGCTACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005116181_1005116186 16 Left 1005116181 6:22340089-22340111 CCCATGTAGCTCTGGACAATTTG No data
Right 1005116186 6:22340128-22340150 TACTGACAAGATGAGGGAAGAGG No data
1005116181_1005116185 10 Left 1005116181 6:22340089-22340111 CCCATGTAGCTCTGGACAATTTG No data
Right 1005116185 6:22340122-22340144 AAATTTTACTGACAAGATGAGGG No data
1005116181_1005116184 9 Left 1005116181 6:22340089-22340111 CCCATGTAGCTCTGGACAATTTG No data
Right 1005116184 6:22340121-22340143 GAAATTTTACTGACAAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005116181 Original CRISPR CAAATTGTCCAGAGCTACAT GGG (reversed) Intergenic
No off target data available for this crispr