ID: 1005117122

View in Genome Browser
Species Human (GRCh38)
Location 6:22351342-22351364
Sequence CATGGTCACCCATCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005117116_1005117122 22 Left 1005117116 6:22351297-22351319 CCATTTTTAATATTTCCATAAAA No data
Right 1005117122 6:22351342-22351364 CATGGTCACCCATCTGAGGAGGG No data
1005117117_1005117122 7 Left 1005117117 6:22351312-22351334 CCATAAAATCACAATTGTAACTG No data
Right 1005117122 6:22351342-22351364 CATGGTCACCCATCTGAGGAGGG No data
1005117115_1005117122 23 Left 1005117115 6:22351296-22351318 CCCATTTTTAATATTTCCATAAA No data
Right 1005117122 6:22351342-22351364 CATGGTCACCCATCTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005117122 Original CRISPR CATGGTCACCCATCTGAGGA GGG Intergenic
No off target data available for this crispr