ID: 1005119771

View in Genome Browser
Species Human (GRCh38)
Location 6:22377244-22377266
Sequence ACCATTAAGGACATAGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25946
Summary {0: 36, 1: 13466, 2: 7673, 3: 2868, 4: 1903}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005119771_1005119777 16 Left 1005119771 6:22377244-22377266 CCCATGCCTATGTCCTTAATGGT 0: 36
1: 13466
2: 7673
3: 2868
4: 1903
Right 1005119777 6:22377283-22377305 TCTAGGACTTTCATGTCTTTAGG No data
1005119771_1005119775 -1 Left 1005119771 6:22377244-22377266 CCCATGCCTATGTCCTTAATGGT 0: 36
1: 13466
2: 7673
3: 2868
4: 1903
Right 1005119775 6:22377266-22377288 TATTGCCTGAGTTTTCTTCTAGG 0: 4
1: 339
2: 9166
3: 11317
4: 5131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005119771 Original CRISPR ACCATTAAGGACATAGGCAT GGG (reversed) Intergenic
Too many off-targets to display for this crispr