ID: 1005119772

View in Genome Browser
Species Human (GRCh38)
Location 6:22377245-22377267
Sequence TACCATTAAGGACATAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005119772_1005119775 -2 Left 1005119772 6:22377245-22377267 CCATGCCTATGTCCTTAATGGTA No data
Right 1005119775 6:22377266-22377288 TATTGCCTGAGTTTTCTTCTAGG 0: 4
1: 339
2: 9166
3: 11317
4: 5131
1005119772_1005119777 15 Left 1005119772 6:22377245-22377267 CCATGCCTATGTCCTTAATGGTA No data
Right 1005119777 6:22377283-22377305 TCTAGGACTTTCATGTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005119772 Original CRISPR TACCATTAAGGACATAGGCA TGG (reversed) Intergenic
No off target data available for this crispr