ID: 1005119773

View in Genome Browser
Species Human (GRCh38)
Location 6:22377250-22377272
Sequence GGCAATACCATTAAGGACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005119773_1005119777 10 Left 1005119773 6:22377250-22377272 CCTATGTCCTTAATGGTATTGCC No data
Right 1005119777 6:22377283-22377305 TCTAGGACTTTCATGTCTTTAGG No data
1005119773_1005119775 -7 Left 1005119773 6:22377250-22377272 CCTATGTCCTTAATGGTATTGCC No data
Right 1005119775 6:22377266-22377288 TATTGCCTGAGTTTTCTTCTAGG 0: 4
1: 339
2: 9166
3: 11317
4: 5131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005119773 Original CRISPR GGCAATACCATTAAGGACAT AGG (reversed) Intergenic
No off target data available for this crispr