ID: 1005119774

View in Genome Browser
Species Human (GRCh38)
Location 6:22377257-22377279
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005119774_1005119777 3 Left 1005119774 6:22377257-22377279 CCTTAATGGTATTGCCTGAGTTT No data
Right 1005119777 6:22377283-22377305 TCTAGGACTTTCATGTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005119774 Original CRISPR AAACTCAGGCAATACCATTA AGG (reversed) Intergenic
No off target data available for this crispr