ID: 1005119775

View in Genome Browser
Species Human (GRCh38)
Location 6:22377266-22377288
Sequence TATTGCCTGAGTTTTCTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25957
Summary {0: 4, 1: 339, 2: 9166, 3: 11317, 4: 5131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005119773_1005119775 -7 Left 1005119773 6:22377250-22377272 CCTATGTCCTTAATGGTATTGCC No data
Right 1005119775 6:22377266-22377288 TATTGCCTGAGTTTTCTTCTAGG 0: 4
1: 339
2: 9166
3: 11317
4: 5131
1005119772_1005119775 -2 Left 1005119772 6:22377245-22377267 CCATGCCTATGTCCTTAATGGTA No data
Right 1005119775 6:22377266-22377288 TATTGCCTGAGTTTTCTTCTAGG 0: 4
1: 339
2: 9166
3: 11317
4: 5131
1005119771_1005119775 -1 Left 1005119771 6:22377244-22377266 CCCATGCCTATGTCCTTAATGGT 0: 36
1: 13466
2: 7673
3: 2868
4: 1903
Right 1005119775 6:22377266-22377288 TATTGCCTGAGTTTTCTTCTAGG 0: 4
1: 339
2: 9166
3: 11317
4: 5131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005119775 Original CRISPR TATTGCCTGAGTTTTCTTCT AGG Intergenic
Too many off-targets to display for this crispr