ID: 1005119777

View in Genome Browser
Species Human (GRCh38)
Location 6:22377283-22377305
Sequence TCTAGGACTTTCATGTCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005119771_1005119777 16 Left 1005119771 6:22377244-22377266 CCCATGCCTATGTCCTTAATGGT 0: 36
1: 13466
2: 7673
3: 2868
4: 1903
Right 1005119777 6:22377283-22377305 TCTAGGACTTTCATGTCTTTAGG No data
1005119772_1005119777 15 Left 1005119772 6:22377245-22377267 CCATGCCTATGTCCTTAATGGTA No data
Right 1005119777 6:22377283-22377305 TCTAGGACTTTCATGTCTTTAGG No data
1005119773_1005119777 10 Left 1005119773 6:22377250-22377272 CCTATGTCCTTAATGGTATTGCC No data
Right 1005119777 6:22377283-22377305 TCTAGGACTTTCATGTCTTTAGG No data
1005119774_1005119777 3 Left 1005119774 6:22377257-22377279 CCTTAATGGTATTGCCTGAGTTT No data
Right 1005119777 6:22377283-22377305 TCTAGGACTTTCATGTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005119777 Original CRISPR TCTAGGACTTTCATGTCTTT AGG Intergenic
No off target data available for this crispr