ID: 1005121093

View in Genome Browser
Species Human (GRCh38)
Location 6:22389986-22390008
Sequence CCTAAGCCTGCCAAGCTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005121093_1005121100 26 Left 1005121093 6:22389986-22390008 CCCGGGAGCTTGGCAGGCTTAGG No data
Right 1005121100 6:22390035-22390057 AATCTGCGCAGCTCCAGGGTTGG No data
1005121093_1005121099 22 Left 1005121093 6:22389986-22390008 CCCGGGAGCTTGGCAGGCTTAGG No data
Right 1005121099 6:22390031-22390053 TGAGAATCTGCGCAGCTCCAGGG No data
1005121093_1005121098 21 Left 1005121093 6:22389986-22390008 CCCGGGAGCTTGGCAGGCTTAGG No data
Right 1005121098 6:22390030-22390052 TTGAGAATCTGCGCAGCTCCAGG No data
1005121093_1005121101 27 Left 1005121093 6:22389986-22390008 CCCGGGAGCTTGGCAGGCTTAGG No data
Right 1005121101 6:22390036-22390058 ATCTGCGCAGCTCCAGGGTTGGG No data
1005121093_1005121096 -5 Left 1005121093 6:22389986-22390008 CCCGGGAGCTTGGCAGGCTTAGG No data
Right 1005121096 6:22390004-22390026 TTAGGCATATTCCAGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005121093 Original CRISPR CCTAAGCCTGCCAAGCTCCC GGG (reversed) Intergenic