ID: 1005121095

View in Genome Browser
Species Human (GRCh38)
Location 6:22389987-22390009
Sequence GCCTAAGCCTGCCAAGCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005121095_1005121096 -6 Left 1005121095 6:22389987-22390009 CCGGGAGCTTGGCAGGCTTAGGC No data
Right 1005121096 6:22390004-22390026 TTAGGCATATTCCAGCTGAGAGG No data
1005121095_1005121098 20 Left 1005121095 6:22389987-22390009 CCGGGAGCTTGGCAGGCTTAGGC No data
Right 1005121098 6:22390030-22390052 TTGAGAATCTGCGCAGCTCCAGG No data
1005121095_1005121099 21 Left 1005121095 6:22389987-22390009 CCGGGAGCTTGGCAGGCTTAGGC No data
Right 1005121099 6:22390031-22390053 TGAGAATCTGCGCAGCTCCAGGG No data
1005121095_1005121101 26 Left 1005121095 6:22389987-22390009 CCGGGAGCTTGGCAGGCTTAGGC No data
Right 1005121101 6:22390036-22390058 ATCTGCGCAGCTCCAGGGTTGGG No data
1005121095_1005121100 25 Left 1005121095 6:22389987-22390009 CCGGGAGCTTGGCAGGCTTAGGC No data
Right 1005121100 6:22390035-22390057 AATCTGCGCAGCTCCAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005121095 Original CRISPR GCCTAAGCCTGCCAAGCTCC CGG (reversed) Intergenic
No off target data available for this crispr