ID: 1005121096

View in Genome Browser
Species Human (GRCh38)
Location 6:22390004-22390026
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005121085_1005121096 9 Left 1005121085 6:22389972-22389994 CCGGTTGCCCCTCCCCCGGGAGC No data
Right 1005121096 6:22390004-22390026 TTAGGCATATTCCAGCTGAGAGG No data
1005121093_1005121096 -5 Left 1005121093 6:22389986-22390008 CCCGGGAGCTTGGCAGGCTTAGG No data
Right 1005121096 6:22390004-22390026 TTAGGCATATTCCAGCTGAGAGG No data
1005121090_1005121096 0 Left 1005121090 6:22389981-22390003 CCTCCCCCGGGAGCTTGGCAGGC No data
Right 1005121096 6:22390004-22390026 TTAGGCATATTCCAGCTGAGAGG No data
1005121092_1005121096 -4 Left 1005121092 6:22389985-22390007 CCCCGGGAGCTTGGCAGGCTTAG No data
Right 1005121096 6:22390004-22390026 TTAGGCATATTCCAGCTGAGAGG No data
1005121091_1005121096 -3 Left 1005121091 6:22389984-22390006 CCCCCGGGAGCTTGGCAGGCTTA No data
Right 1005121096 6:22390004-22390026 TTAGGCATATTCCAGCTGAGAGG No data
1005121088_1005121096 1 Left 1005121088 6:22389980-22390002 CCCTCCCCCGGGAGCTTGGCAGG No data
Right 1005121096 6:22390004-22390026 TTAGGCATATTCCAGCTGAGAGG No data
1005121095_1005121096 -6 Left 1005121095 6:22389987-22390009 CCGGGAGCTTGGCAGGCTTAGGC No data
Right 1005121096 6:22390004-22390026 TTAGGCATATTCCAGCTGAGAGG No data
1005121087_1005121096 2 Left 1005121087 6:22389979-22390001 CCCCTCCCCCGGGAGCTTGGCAG No data
Right 1005121096 6:22390004-22390026 TTAGGCATATTCCAGCTGAGAGG No data
1005121082_1005121096 23 Left 1005121082 6:22389958-22389980 CCATAGCTGTGGTGCCGGTTGCC No data
Right 1005121096 6:22390004-22390026 TTAGGCATATTCCAGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005121096 Original CRISPR TTAGGCATATTCCAGCTGAG AGG Intergenic