ID: 1005121097

View in Genome Browser
Species Human (GRCh38)
Location 6:22390015-22390037
Sequence ATTCTCAACAGCCTCTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005121097_1005121106 20 Left 1005121097 6:22390015-22390037 CCAGCTGAGAGGCTGTTGAGAAT No data
Right 1005121106 6:22390058-22390080 GACCCTAGGCCCTGGTGGTGTGG No data
1005121097_1005121107 21 Left 1005121097 6:22390015-22390037 CCAGCTGAGAGGCTGTTGAGAAT No data
Right 1005121107 6:22390059-22390081 ACCCTAGGCCCTGGTGGTGTGGG No data
1005121097_1005121098 -8 Left 1005121097 6:22390015-22390037 CCAGCTGAGAGGCTGTTGAGAAT No data
Right 1005121098 6:22390030-22390052 TTGAGAATCTGCGCAGCTCCAGG No data
1005121097_1005121104 12 Left 1005121097 6:22390015-22390037 CCAGCTGAGAGGCTGTTGAGAAT No data
Right 1005121104 6:22390050-22390072 AGGGTTGGGACCCTAGGCCCTGG No data
1005121097_1005121101 -2 Left 1005121097 6:22390015-22390037 CCAGCTGAGAGGCTGTTGAGAAT No data
Right 1005121101 6:22390036-22390058 ATCTGCGCAGCTCCAGGGTTGGG No data
1005121097_1005121099 -7 Left 1005121097 6:22390015-22390037 CCAGCTGAGAGGCTGTTGAGAAT No data
Right 1005121099 6:22390031-22390053 TGAGAATCTGCGCAGCTCCAGGG No data
1005121097_1005121102 6 Left 1005121097 6:22390015-22390037 CCAGCTGAGAGGCTGTTGAGAAT No data
Right 1005121102 6:22390044-22390066 AGCTCCAGGGTTGGGACCCTAGG No data
1005121097_1005121100 -3 Left 1005121097 6:22390015-22390037 CCAGCTGAGAGGCTGTTGAGAAT No data
Right 1005121100 6:22390035-22390057 AATCTGCGCAGCTCCAGGGTTGG No data
1005121097_1005121105 15 Left 1005121097 6:22390015-22390037 CCAGCTGAGAGGCTGTTGAGAAT No data
Right 1005121105 6:22390053-22390075 GTTGGGACCCTAGGCCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005121097 Original CRISPR ATTCTCAACAGCCTCTCAGC TGG (reversed) Intergenic