ID: 1005121099

View in Genome Browser
Species Human (GRCh38)
Location 6:22390031-22390053
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005121093_1005121099 22 Left 1005121093 6:22389986-22390008 CCCGGGAGCTTGGCAGGCTTAGG No data
Right 1005121099 6:22390031-22390053 TGAGAATCTGCGCAGCTCCAGGG No data
1005121090_1005121099 27 Left 1005121090 6:22389981-22390003 CCTCCCCCGGGAGCTTGGCAGGC No data
Right 1005121099 6:22390031-22390053 TGAGAATCTGCGCAGCTCCAGGG No data
1005121088_1005121099 28 Left 1005121088 6:22389980-22390002 CCCTCCCCCGGGAGCTTGGCAGG No data
Right 1005121099 6:22390031-22390053 TGAGAATCTGCGCAGCTCCAGGG No data
1005121095_1005121099 21 Left 1005121095 6:22389987-22390009 CCGGGAGCTTGGCAGGCTTAGGC No data
Right 1005121099 6:22390031-22390053 TGAGAATCTGCGCAGCTCCAGGG No data
1005121097_1005121099 -7 Left 1005121097 6:22390015-22390037 CCAGCTGAGAGGCTGTTGAGAAT No data
Right 1005121099 6:22390031-22390053 TGAGAATCTGCGCAGCTCCAGGG No data
1005121087_1005121099 29 Left 1005121087 6:22389979-22390001 CCCCTCCCCCGGGAGCTTGGCAG No data
Right 1005121099 6:22390031-22390053 TGAGAATCTGCGCAGCTCCAGGG No data
1005121091_1005121099 24 Left 1005121091 6:22389984-22390006 CCCCCGGGAGCTTGGCAGGCTTA No data
Right 1005121099 6:22390031-22390053 TGAGAATCTGCGCAGCTCCAGGG No data
1005121092_1005121099 23 Left 1005121092 6:22389985-22390007 CCCCGGGAGCTTGGCAGGCTTAG No data
Right 1005121099 6:22390031-22390053 TGAGAATCTGCGCAGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005121099 Original CRISPR TGAGAATCTGCGCAGCTCCA GGG Intergenic