ID: 1005121100

View in Genome Browser
Species Human (GRCh38)
Location 6:22390035-22390057
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005121097_1005121100 -3 Left 1005121097 6:22390015-22390037 CCAGCTGAGAGGCTGTTGAGAAT No data
Right 1005121100 6:22390035-22390057 AATCTGCGCAGCTCCAGGGTTGG No data
1005121093_1005121100 26 Left 1005121093 6:22389986-22390008 CCCGGGAGCTTGGCAGGCTTAGG No data
Right 1005121100 6:22390035-22390057 AATCTGCGCAGCTCCAGGGTTGG No data
1005121095_1005121100 25 Left 1005121095 6:22389987-22390009 CCGGGAGCTTGGCAGGCTTAGGC No data
Right 1005121100 6:22390035-22390057 AATCTGCGCAGCTCCAGGGTTGG No data
1005121092_1005121100 27 Left 1005121092 6:22389985-22390007 CCCCGGGAGCTTGGCAGGCTTAG No data
Right 1005121100 6:22390035-22390057 AATCTGCGCAGCTCCAGGGTTGG No data
1005121091_1005121100 28 Left 1005121091 6:22389984-22390006 CCCCCGGGAGCTTGGCAGGCTTA No data
Right 1005121100 6:22390035-22390057 AATCTGCGCAGCTCCAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005121100 Original CRISPR AATCTGCGCAGCTCCAGGGT TGG Intergenic