ID: 1005122869

View in Genome Browser
Species Human (GRCh38)
Location 6:22409971-22409993
Sequence CCTCCCTGCCCCTTATCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005122865_1005122869 30 Left 1005122865 6:22409918-22409940 CCAATGTAGTGGAGTGCAGTGGA No data
Right 1005122869 6:22409971-22409993 CCTCCCTGCCCCTTATCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005122869 Original CRISPR CCTCCCTGCCCCTTATCCCA AGG Intergenic
No off target data available for this crispr