ID: 1005124414

View in Genome Browser
Species Human (GRCh38)
Location 6:22429981-22430003
Sequence CAGAGCTCTGCGTGGGCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005124414_1005124419 27 Left 1005124414 6:22429981-22430003 CCGTGAGCCCACGCAGAGCTCTG No data
Right 1005124419 6:22430031-22430053 CTTTCTGACATTTTCTTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005124414 Original CRISPR CAGAGCTCTGCGTGGGCTCA CGG (reversed) Intergenic
No off target data available for this crispr