ID: 1005126073

View in Genome Browser
Species Human (GRCh38)
Location 6:22448110-22448132
Sequence GGAAGATTCTTACATGCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005126073_1005126075 -6 Left 1005126073 6:22448110-22448132 CCGGGTGCATGTAAGAATCTTCC No data
Right 1005126075 6:22448127-22448149 TCTTCCATCCTTATACCCACGGG No data
1005126073_1005126081 13 Left 1005126073 6:22448110-22448132 CCGGGTGCATGTAAGAATCTTCC No data
Right 1005126081 6:22448146-22448168 CGGGTAAACAAAGGATCCCACGG No data
1005126073_1005126082 14 Left 1005126073 6:22448110-22448132 CCGGGTGCATGTAAGAATCTTCC No data
Right 1005126082 6:22448147-22448169 GGGTAAACAAAGGATCCCACGGG No data
1005126073_1005126074 -7 Left 1005126073 6:22448110-22448132 CCGGGTGCATGTAAGAATCTTCC No data
Right 1005126074 6:22448126-22448148 ATCTTCCATCCTTATACCCACGG No data
1005126073_1005126078 4 Left 1005126073 6:22448110-22448132 CCGGGTGCATGTAAGAATCTTCC No data
Right 1005126078 6:22448137-22448159 TTATACCCACGGGTAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005126073 Original CRISPR GGAAGATTCTTACATGCACC CGG (reversed) Intergenic
No off target data available for this crispr