ID: 1005126076

View in Genome Browser
Species Human (GRCh38)
Location 6:22448131-22448153
Sequence TTTACCCGTGGGTATAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005126076_1005126081 -8 Left 1005126076 6:22448131-22448153 CCATCCTTATACCCACGGGTAAA No data
Right 1005126081 6:22448146-22448168 CGGGTAAACAAAGGATCCCACGG No data
1005126076_1005126082 -7 Left 1005126076 6:22448131-22448153 CCATCCTTATACCCACGGGTAAA No data
Right 1005126082 6:22448147-22448169 GGGTAAACAAAGGATCCCACGGG No data
1005126076_1005126085 11 Left 1005126076 6:22448131-22448153 CCATCCTTATACCCACGGGTAAA No data
Right 1005126085 6:22448165-22448187 ACGGGCTGTTGCCTATCCCTAGG No data
1005126076_1005126086 12 Left 1005126076 6:22448131-22448153 CCATCCTTATACCCACGGGTAAA No data
Right 1005126086 6:22448166-22448188 CGGGCTGTTGCCTATCCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005126076 Original CRISPR TTTACCCGTGGGTATAAGGA TGG (reversed) Intergenic
No off target data available for this crispr