ID: 1005126082

View in Genome Browser
Species Human (GRCh38)
Location 6:22448147-22448169
Sequence GGGTAAACAAAGGATCCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005126072_1005126082 15 Left 1005126072 6:22448109-22448131 CCCGGGTGCATGTAAGAATCTTC No data
Right 1005126082 6:22448147-22448169 GGGTAAACAAAGGATCCCACGGG No data
1005126073_1005126082 14 Left 1005126073 6:22448110-22448132 CCGGGTGCATGTAAGAATCTTCC No data
Right 1005126082 6:22448147-22448169 GGGTAAACAAAGGATCCCACGGG No data
1005126076_1005126082 -7 Left 1005126076 6:22448131-22448153 CCATCCTTATACCCACGGGTAAA No data
Right 1005126082 6:22448147-22448169 GGGTAAACAAAGGATCCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005126082 Original CRISPR GGGTAAACAAAGGATCCCAC GGG Intergenic
No off target data available for this crispr