ID: 1005127891

View in Genome Browser
Species Human (GRCh38)
Location 6:22469946-22469968
Sequence GTTGTCTTGATACCAAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005127891_1005127893 3 Left 1005127891 6:22469946-22469968 CCAAGTTTTGGTATCAAGACAAC No data
Right 1005127893 6:22469972-22469994 AAAGAAATATCATCCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005127891 Original CRISPR GTTGTCTTGATACCAAAACT TGG (reversed) Intergenic
No off target data available for this crispr