ID: 1005130333

View in Genome Browser
Species Human (GRCh38)
Location 6:22499719-22499741
Sequence TGATGAGAAAGACAAGTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005130333_1005130336 7 Left 1005130333 6:22499719-22499741 CCACTAACTTGTCTTTCTCATCA No data
Right 1005130336 6:22499749-22499771 AATTCCTTACAGCATTAATGAGG No data
1005130333_1005130338 17 Left 1005130333 6:22499719-22499741 CCACTAACTTGTCTTTCTCATCA No data
Right 1005130338 6:22499759-22499781 AGCATTAATGAGGTATTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005130333 Original CRISPR TGATGAGAAAGACAAGTTAG TGG (reversed) Intergenic
No off target data available for this crispr