ID: 1005130335

View in Genome Browser
Species Human (GRCh38)
Location 6:22499743-22499765
Sequence TAATGCTGTAAGGAATTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005130335_1005130339 12 Left 1005130335 6:22499743-22499765 CCTGAGAATTCCTTACAGCATTA No data
Right 1005130339 6:22499778-22499800 ATGGCTTTGTAAATGATGATTGG No data
1005130335_1005130338 -7 Left 1005130335 6:22499743-22499765 CCTGAGAATTCCTTACAGCATTA No data
Right 1005130338 6:22499759-22499781 AGCATTAATGAGGTATTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005130335 Original CRISPR TAATGCTGTAAGGAATTCTC AGG (reversed) Intergenic
No off target data available for this crispr