ID: 1005131431

View in Genome Browser
Species Human (GRCh38)
Location 6:22513026-22513048
Sequence CAGTGAGCCAAGAGAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005131430_1005131431 -1 Left 1005131430 6:22513004-22513026 CCAGAGTGGAGAGACTACAAATC No data
Right 1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005131431 Original CRISPR CAGTGAGCCAAGAGAGAAGA TGG Intergenic
No off target data available for this crispr