ID: 1005134441

View in Genome Browser
Species Human (GRCh38)
Location 6:22551711-22551733
Sequence TTCAGACAGCTCTACATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005134441_1005134442 8 Left 1005134441 6:22551711-22551733 CCTGAAATGTAGAGCTGTCTGAA No data
Right 1005134442 6:22551742-22551764 CTTGTTCATCAGCCCACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005134441 Original CRISPR TTCAGACAGCTCTACATTTC AGG (reversed) Intergenic
No off target data available for this crispr