ID: 1005136961

View in Genome Browser
Species Human (GRCh38)
Location 6:22580272-22580294
Sequence CTGATCCTGTAGGACCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005136956_1005136961 12 Left 1005136956 6:22580237-22580259 CCTCCAAGAAGCTGCATATTGGT No data
Right 1005136961 6:22580272-22580294 CTGATCCTGTAGGACCAGGATGG No data
1005136957_1005136961 9 Left 1005136957 6:22580240-22580262 CCAAGAAGCTGCATATTGGTGAA No data
Right 1005136961 6:22580272-22580294 CTGATCCTGTAGGACCAGGATGG No data
1005136954_1005136961 15 Left 1005136954 6:22580234-22580256 CCTCCTCCAAGAAGCTGCATATT No data
Right 1005136961 6:22580272-22580294 CTGATCCTGTAGGACCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005136961 Original CRISPR CTGATCCTGTAGGACCAGGA TGG Intergenic
No off target data available for this crispr