ID: 1005138461

View in Genome Browser
Species Human (GRCh38)
Location 6:22598907-22598929
Sequence TAGTATCTCCACGAAGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005138461_1005138462 6 Left 1005138461 6:22598907-22598929 CCTGTGGCTTCGTGGAGATACTA No data
Right 1005138462 6:22598936-22598958 CTCTGCATTTTGCTTTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005138461 Original CRISPR TAGTATCTCCACGAAGCCAC AGG (reversed) Intergenic
No off target data available for this crispr