ID: 1005140465 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:22626181-22626203 |
Sequence | CAGGAAAGGAGGGTGGGGGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1005140465_1005140485 | 30 | Left | 1005140465 | 6:22626181-22626203 | CCAGCCCCCACCCTCCTTTCCTG | No data | ||
Right | 1005140485 | 6:22626234-22626256 | CGCTGCCTATGGACTGCAGACGG | No data | ||||
1005140465_1005140474 | -9 | Left | 1005140465 | 6:22626181-22626203 | CCAGCCCCCACCCTCCTTTCCTG | No data | ||
Right | 1005140474 | 6:22626195-22626217 | CCTTTCCTGTGCCAGGCCCTAGG | No data | ||||
1005140465_1005140481 | 19 | Left | 1005140465 | 6:22626181-22626203 | CCAGCCCCCACCCTCCTTTCCTG | No data | ||
Right | 1005140481 | 6:22626223-22626245 | CTTGTCCAACCCGCTGCCTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1005140465 | Original CRISPR | CAGGAAAGGAGGGTGGGGGC TGG (reversed) | Intergenic | ||
No off target data available for this crispr |