ID: 1005140468

View in Genome Browser
Species Human (GRCh38)
Location 6:22626187-22626209
Sequence CTGGCACAGGAAAGGAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005140468_1005140487 30 Left 1005140468 6:22626187-22626209 CCCACCCTCCTTTCCTGTGCCAG No data
Right 1005140487 6:22626240-22626262 CTATGGACTGCAGACGGCCCAGG No data
1005140468_1005140485 24 Left 1005140468 6:22626187-22626209 CCCACCCTCCTTTCCTGTGCCAG No data
Right 1005140485 6:22626234-22626256 CGCTGCCTATGGACTGCAGACGG No data
1005140468_1005140481 13 Left 1005140468 6:22626187-22626209 CCCACCCTCCTTTCCTGTGCCAG No data
Right 1005140481 6:22626223-22626245 CTTGTCCAACCCGCTGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005140468 Original CRISPR CTGGCACAGGAAAGGAGGGT GGG (reversed) Intergenic
No off target data available for this crispr